View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745_low_34 (Length: 239)
Name: NF4745_low_34
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 30551063 - 30550838
Alignment:
| Q |
1 |
ctggtacacataataaatgacagtgttcaacaactatgttgtagtnnnnnnntctatagtatcatatgtaaccacaagttcataacttaagcacatggtt |
100 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||| ||||| |||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
30551063 |
ctggtacacataacaaa-gacagtgttcaacaactatgttgtagtaaaaaaatctatcgtatcatatgtaactataagtccataacttaagcacatggtt |
30550965 |
T |
 |
| Q |
101 |
cggctcaaatgattaatgagatttagttaatga-----cattcgaaaacacacaagttcgaaaccttgctataacaatctttggccacgatttattcact |
195 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30550964 |
cagctcaaatgattaatgagatttagttaatgaagaaacattcgaaaacacacaagttcgaagccttgctataacaatctttggccacgatttattcact |
30550865 |
T |
 |
| Q |
196 |
gatattatcctaaccaaagcttgataa |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30550864 |
gatattatcctaaccaaagcttgataa |
30550838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University