View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745_low_36 (Length: 237)
Name: NF4745_low_36
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 3 - 234
Target Start/End: Complemental strand, 23714202 - 23713971
Alignment:
| Q |
3 |
tgcacatgaaagctaagtagtaaactcaaatagttggtaagaactcaaagggtgtcaaattacctcagagatattgtcatctattcgatcagagtgtgga |
102 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23714202 |
tgcacataaaagcaaagcagtaaactcaaatagttggtaagaaatcaaagggtgtcaaattacctcagatatattgtcatctattcgatcagagtgtgga |
23714103 |
T |
|
| Q |
103 |
gatggaagagagtaaggactgcctttcaatatgtttttctccctttccctgttcgcgtccaacaaggcctgctctaataaaactttagcctctggattaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23714102 |
gatggaagagagtaaggactgcctttcaatatgtttttctccctttccctgttcgcgtccaacaaggcctgctctaataaaactttagcctctggattaa |
23714003 |
T |
|
| Q |
203 |
gctcgctgattatcttcaatgatgatgtccat |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
23714002 |
gctcgctgattatcttcaatgatgatggccat |
23713971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University