View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745_low_37 (Length: 234)
Name: NF4745_low_37
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 683843 - 683730
Alignment:
| Q |
107 |
tcagaatcaatatcttattagtatatactaacattaaggcgtaaaatgtggcacttgttaggaatgaaatttttgaaatcaacaacgttcttgatcttat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
683843 |
tcagaatcaatatcttattagtatatactaacattaaggcgtaaaatgtggcacttgttaggaatgaaatttttgaaatcaacaacgttcttgatcttat |
683744 |
T |
 |
| Q |
207 |
tatcactaacatct |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
683743 |
tatcactaacatct |
683730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 211
Target Start/End: Complemental strand, 646067 - 645991
Alignment:
| Q |
135 |
taacattaaggcgtaaaatgtggcacttgttaggaatgaaatttttgaaatcaacaacgttcttgatcttattatca |
211 |
Q |
| |
|
|||| |||||||||||||| |||||||| ||||||| ||| ||| |||||||||||| | |||||||||||||||| |
|
|
| T |
646067 |
taactttaaggcgtaaaatatggcacttcttaggaacgaagtttccgaaatcaacaacatccttgatcttattatca |
645991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University