View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4745_low_40 (Length: 227)
Name: NF4745_low_40
Description: NF4745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4745_low_40 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 2781267 - 2781482
Alignment:
| Q |
6 |
agaatccacatgtcactttaaacttcaactagtaaagattccatgcaagattacactgacatgtaagtatgtcttctacagattattcttcaaaaaatca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2781267 |
agaatccacatgtcactttaaacttcaactagtaaagattccatgcaagattacactgacatgtaaat------tctacagattattcttcaaaaaatca |
2781360 |
T |
|
| Q |
106 |
agaaaattgaatagaaaaggttaataaactcatatcatatcattataatatggtataatataattaccaaaggcacaaagtatttggaaatgcgatcagc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2781361 |
agaaaattgaatagaaaaggttaataaactcatatcatatcattataatatggtataatataattaccaaaggcacaaagtatttggaaatgcgatcagc |
2781460 |
T |
|
| Q |
206 |
aaacttctggacaggagcttta |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2781461 |
aaacttctggacaggagcttta |
2781482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University