View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4746-Insertion-10 (Length: 721)

Name: NF4746-Insertion-10
Description: NF4746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4746-Insertion-10
NF4746-Insertion-10
[»] chr6 (29 HSPs)
chr6 (8-721)||(13627835-13628543)
chr6 (187-296)||(29355859-29355970)
chr6 (187-296)||(12221918-12222030)
chr6 (187-296)||(1354761-1354868)
chr6 (187-296)||(1346986-1347093)
chr6 (189-289)||(1941879-1941979)
chr6 (187-296)||(26097182-26097289)
chr6 (223-296)||(383764-383837)
chr6 (187-287)||(7947384-7947485)
chr6 (187-288)||(9161145-9161247)
chr6 (237-296)||(3116133-3116192)
chr6 (187-296)||(25557747-25557854)
chr6 (187-283)||(32579448-32579543)
chr6 (188-235)||(6024256-6024303)
chr6 (187-290)||(18277203-18277306)
chr6 (187-289)||(23930138-23930238)
chr6 (187-233)||(8409265-8409311)
chr6 (221-296)||(12885967-12886044)
chr6 (187-289)||(33138855-33138957)
chr6 (214-296)||(17432395-17432479)
chr6 (187-287)||(23240837-23240935)
chr6 (187-288)||(32728169-32728269)
chr6 (198-300)||(24751068-24751176)
chr6 (187-290)||(3815087-3815190)
chr6 (187-254)||(12228380-12228447)
chr6 (187-242)||(20400689-20400744)
chr6 (192-284)||(24097608-24097696)
chr6 (187-287)||(15866052-15866150)
chr6 (263-296)||(30786378-30786411)
[»] chr2 (49 HSPs)
chr2 (187-296)||(11514458-11514566)
chr2 (187-296)||(8455320-8455429)
chr2 (187-296)||(9671203-9671310)
chr2 (187-296)||(10546184-10546294)
chr2 (187-301)||(10543720-10543836)
chr2 (187-296)||(14530340-14530451)
chr2 (187-296)||(36871515-36871622)
chr2 (186-280)||(32781308-32781402)
chr2 (187-301)||(40762233-40762347)
chr2 (188-284)||(99281-99375)
chr2 (187-288)||(14444751-14444851)
chr2 (188-303)||(25079714-25079830)
chr2 (180-307)||(19977707-19977834)
chr2 (218-296)||(24859992-24860070)
chr2 (195-296)||(17668032-17668133)
chr2 (188-296)||(17623587-17623695)
chr2 (187-296)||(24200627-24200738)
chr2 (188-286)||(17896282-17896381)
chr2 (188-290)||(4516361-4516463)
chr2 (191-296)||(21779265-21779368)
chr2 (187-296)||(23397788-23397895)
chr2 (205-287)||(24890451-24890533)
chr2 (187-296)||(25249742-25249850)
chr2 (204-301)||(25632548-25632645)
chr2 (205-294)||(26684626-26684715)
chr2 (205-290)||(44643563-44643648)
chr2 (187-288)||(7214556-7214659)
chr2 (187-290)||(12023929-12024031)
chr2 (207-294)||(25641543-25641630)
chr2 (187-294)||(30826059-30826164)
chr2 (180-285)||(15296421-15296527)
chr2 (187-296)||(39914310-39914419)
chr2 (189-294)||(31158445-31158552)
chr2 (214-294)||(39499236-39499316)
chr2 (188-288)||(19615015-19615116)
chr2 (214-284)||(13245111-13245181)
chr2 (187-281)||(44521392-44521486)
chr2 (203-296)||(12315656-12315749)
chr2 (188-291)||(17471571-17471676)
chr2 (187-254)||(22371079-22371143)
chr2 (180-280)||(33795300-33795400)
chr2 (187-254)||(5450307-5450375)
chr2 (660-715)||(19569593-19569648)
chr2 (263-301)||(124913-124951)
chr2 (189-235)||(23145763-23145809)
chr2 (189-235)||(23557553-23557599)
chr2 (190-296)||(27573646-27573751)
chr2 (187-293)||(30864424-30864529)
chr2 (263-296)||(22371210-22371243)
[»] chr8 (41 HSPs)
chr8 (187-295)||(29521690-29521798)
chr8 (180-296)||(45071280-45071395)
chr8 (187-296)||(28817630-28817739)
chr8 (187-288)||(36720818-36720919)
chr8 (187-296)||(39460998-39461109)
chr8 (187-290)||(44530171-44530274)
chr8 (187-305)||(35261701-35261819)
chr8 (187-288)||(29877116-29877217)
chr8 (187-296)||(6760844-6760955)
chr8 (188-296)||(13160725-13160832)
chr8 (187-290)||(8483948-8484051)
chr8 (187-296)||(30454101-30454208)
chr8 (187-296)||(26954154-26954266)
chr8 (187-290)||(12670260-12670361)
chr8 (187-301)||(2626541-2626658)
chr8 (187-290)||(5135300-5135402)
chr8 (193-295)||(5689659-5689761)
chr8 (187-296)||(10857850-10857960)
chr8 (187-296)||(12625911-12626021)
chr8 (187-300)||(18164760-18164872)
chr8 (187-290)||(20284079-20284186)
chr8 (187-288)||(22598179-22598279)
chr8 (187-296)||(20869945-20870056)
chr8 (187-290)||(21070707-21070815)
chr8 (187-290)||(7136537-7136642)
chr8 (188-289)||(24365071-24365172)
chr8 (187-288)||(8897776-8897877)
chr8 (217-296)||(31457224-31457303)
chr8 (180-290)||(44742528-44742639)
chr8 (187-287)||(44781517-44781619)
chr8 (187-293)||(389665-389773)
chr8 (187-296)||(17823598-17823707)
chr8 (207-296)||(19729382-19729471)
chr8 (214-290)||(26457778-26457852)
chr8 (222-290)||(16013511-16013581)
chr8 (187-240)||(14018029-14018082)
chr8 (664-721)||(15151313-15151370)
chr8 (664-715)||(16822009-16822060)
chr8 (226-296)||(26102578-26102648)
chr8 (189-235)||(43942348-43942394)
chr8 (263-296)||(27468096-27468129)
[»] chr1 (52 HSPs)
chr1 (187-295)||(23768325-23768433)
chr1 (187-296)||(46247957-46248066)
chr1 (187-290)||(23796510-23796613)
chr1 (204-296)||(4349700-4349792)
chr1 (187-296)||(10668270-10668381)
chr1 (187-296)||(20004094-20004205)
chr1 (194-296)||(1517315-1517418)
chr1 (187-290)||(14617083-14617186)
chr1 (187-296)||(34725102-34725209)
chr1 (187-296)||(18944688-18944800)
chr1 (187-296)||(27474326-27474434)
chr1 (188-296)||(35253191-35253297)
chr1 (187-296)||(46991849-46991958)
chr1 (188-307)||(38478275-38478392)
chr1 (187-286)||(27201692-27201793)
chr1 (189-296)||(35005170-35005279)
chr1 (187-289)||(30395737-30395841)
chr1 (187-288)||(32632569-32632669)
chr1 (207-290)||(10378745-10378828)
chr1 (221-296)||(45402175-45402250)
chr1 (187-293)||(47214556-47214660)
chr1 (187-289)||(6925145-6925247)
chr1 (180-287)||(12126850-12126955)
chr1 (205-290)||(18741967-18742054)
chr1 (180-291)||(27136660-27136772)
chr1 (187-290)||(9939506-9939612)
chr1 (188-286)||(17470361-17470458)
chr1 (187-290)||(44485120-44485222)
chr1 (194-296)||(8197095-8197197)
chr1 (187-288)||(45264411-45264513)
chr1 (187-280)||(18724565-18724658)
chr1 (187-296)||(31382218-31382326)
chr1 (206-296)||(42304211-42304303)
chr1 (189-288)||(19701617-19701717)
chr1 (660-715)||(23971075-23971130)
chr1 (187-278)||(25468285-25468376)
chr1 (187-254)||(41319852-41319919)
chr1 (208-290)||(43768205-43768287)
chr1 (214-296)||(45812541-45812623)
chr1 (207-296)||(19414502-19414591)
chr1 (193-290)||(20999860-20999957)
chr1 (188-280)||(11596559-11596650)
chr1 (189-300)||(35019277-35019387)
chr1 (187-290)||(6983821-6983922)
chr1 (187-290)||(39214968-39215072)
chr1 (214-289)||(15505636-15505710)
chr1 (187-290)||(15511158-15511264)
chr1 (187-254)||(34149006-34149073)
chr1 (187-290)||(35117775-35117881)
chr1 (205-290)||(46859129-46859215)
chr1 (188-229)||(25027989-25028030)
chr1 (246-287)||(33594144-33594185)
[»] chr3 (60 HSPs)
chr3 (187-296)||(54484734-54484844)
chr3 (187-296)||(40272816-40272925)
chr3 (187-296)||(12914039-12914148)
chr3 (187-296)||(22609810-22609918)
chr3 (189-289)||(6411833-6411932)
chr3 (187-296)||(13628794-13628905)
chr3 (187-290)||(45948848-45948951)
chr3 (187-290)||(14987001-14987106)
chr3 (187-296)||(25517174-25517284)
chr3 (187-287)||(34420656-34420757)
chr3 (188-296)||(39203561-39203667)
chr3 (187-296)||(46421038-46421150)
chr3 (187-296)||(29366724-29366835)
chr3 (187-307)||(49013466-49013588)
chr3 (189-296)||(45786218-45786327)
chr3 (187-296)||(7943034-7943143)
chr3 (187-288)||(26573171-26573272)
chr3 (187-296)||(26869751-26869859)
chr3 (187-296)||(13730606-13730717)
chr3 (187-301)||(31592893-31593005)
chr3 (187-296)||(516453-516565)
chr3 (187-296)||(1217134-1217241)
chr3 (187-288)||(31904868-31904970)
chr3 (187-288)||(10795435-10795538)
chr3 (187-290)||(53996575-53996679)
chr3 (187-290)||(19731046-19731149)
chr3 (207-290)||(34771374-34771457)
chr3 (187-296)||(22122921-22123028)
chr3 (189-290)||(55401222-55401324)
chr3 (187-281)||(8247706-8247802)
chr3 (192-281)||(9276313-9276401)
chr3 (207-296)||(15797284-15797373)
chr3 (215-296)||(52926223-52926304)
chr3 (188-296)||(16735486-16735593)
chr3 (193-288)||(33235581-33235676)
chr3 (187-290)||(52428480-52428590)
chr3 (204-296)||(353353-353447)
chr3 (187-290)||(19751622-19751725)
chr3 (187-288)||(31672737-31672839)
chr3 (187-288)||(54374357-54374459)
chr3 (189-254)||(47624088-47624152)
chr3 (187-296)||(5173723-5173833)
chr3 (180-235)||(45620893-45620949)
chr3 (193-305)||(4495671-4495771)
chr3 (187-283)||(9607247-9607345)
chr3 (187-241)||(21875057-21875112)
chr3 (660-714)||(9021814-9021868)
chr3 (193-290)||(44403565-44403663)
chr3 (187-290)||(45139488-45139591)
chr3 (225-306)||(24577917-24577998)
chr3 (187-280)||(30928167-30928260)
chr3 (187-235)||(54032624-54032672)
chr3 (188-290)||(829452-829555)
chr3 (237-296)||(24851305-24851364)
chr3 (187-288)||(25944513-25944615)
chr3 (250-288)||(31922851-31922889)
chr3 (263-296)||(10484620-10484653)
chr3 (263-296)||(40390361-40390394)
chr3 (263-296)||(47624219-47624252)
chr3 (263-296)||(54032575-54032608)
[»] chr4 (58 HSPs)
chr4 (187-296)||(20639662-20639772)
chr4 (187-296)||(40915851-40915959)
chr4 (189-296)||(51865042-51865149)
chr4 (187-296)||(5648281-5648389)
chr4 (187-296)||(6430630-6430738)
chr4 (187-296)||(30639402-30639510)
chr4 (188-284)||(14983857-14983953)
chr4 (187-281)||(17043413-17043507)
chr4 (187-296)||(25629071-25629180)
chr4 (187-296)||(47443979-47444088)
chr4 (187-291)||(19027870-19027974)
chr4 (187-296)||(21646986-21647097)
chr4 (191-296)||(23501813-23501920)
chr4 (187-301)||(20225006-20225118)
chr4 (187-290)||(35567192-35567295)
chr4 (187-296)||(48598829-48598936)
chr4 (207-296)||(29207902-29207991)
chr4 (187-296)||(16408605-16408716)
chr4 (204-288)||(30690188-30690272)
chr4 (187-290)||(9987844-9987947)
chr4 (193-296)||(13256403-13256508)
chr4 (189-296)||(44363134-44363243)
chr4 (187-296)||(47528534-47528641)
chr4 (208-290)||(55766476-55766558)
chr4 (188-296)||(10277761-10277867)
chr4 (187-287)||(20908649-20908750)
chr4 (214-287)||(41018807-41018880)
chr4 (189-296)||(9832317-9832422)
chr4 (187-279)||(49796820-49796911)
chr4 (205-288)||(12711461-12711544)
chr4 (188-296)||(16911585-16911695)
chr4 (180-288)||(25343202-25343312)
chr4 (189-290)||(54175088-54175190)
chr4 (187-296)||(7909284-7909393)
chr4 (215-289)||(30352591-30352667)
chr4 (187-239)||(487196-487248)
chr4 (187-296)||(5306664-5306776)
chr4 (187-235)||(39029126-39029174)
chr4 (208-288)||(55830733-55830813)
chr4 (187-286)||(37494873-37494972)
chr4 (188-286)||(20405109-20405210)
chr4 (187-296)||(39077800-39077907)
chr4 (207-296)||(11054152-11054241)
chr4 (214-296)||(20225123-20225207)
chr4 (187-287)||(21489109-21489210)
chr4 (187-280)||(25463144-25463237)
chr4 (261-296)||(48033422-48033457)
chr4 (665-715)||(17405187-17405237)
chr4 (262-296)||(19425922-19425956)
chr4 (248-290)||(34256992-34257034)
chr4 (246-296)||(38755912-38755962)
chr4 (246-296)||(40553941-40553991)
chr4 (187-281)||(10660426-10660521)
chr4 (187-281)||(10874571-10874666)
chr4 (263-296)||(11394950-11394983)
chr4 (263-296)||(11404677-11404710)
chr4 (237-290)||(28494223-28494276)
chr4 (263-296)||(35532090-35532123)
[»] chr7 (47 HSPs)
chr7 (187-296)||(7879660-7879769)
chr7 (187-290)||(2541029-2541132)
chr7 (180-286)||(23419688-23419794)
chr7 (187-296)||(42798691-42798800)
chr7 (187-290)||(38604549-38604652)
chr7 (187-296)||(21172013-21172120)
chr7 (188-290)||(28362156-28362257)
chr7 (187-296)||(1408479-1408588)
chr7 (187-296)||(11617592-11617701)
chr7 (187-296)||(42805546-42805657)
chr7 (187-296)||(47716481-47716592)
chr7 (187-296)||(31591113-31591220)
chr7 (187-296)||(32758283-32758390)
chr7 (190-296)||(35787273-35787378)
chr7 (187-296)||(42391104-42391211)
chr7 (187-296)||(48735126-48735233)
chr7 (187-296)||(19426894-19427002)
chr7 (187-296)||(27629656-27629765)
chr7 (187-288)||(33871922-33872022)
chr7 (188-289)||(40463900-40464000)
chr7 (448-554)||(9416179-9416284)
chr7 (187-296)||(10693077-10693184)
chr7 (187-296)||(34626212-34626320)
chr7 (187-296)||(38262200-38262309)
chr7 (180-288)||(42476888-42476994)
chr7 (187-296)||(43557494-43557606)
chr7 (195-286)||(8148960-8149051)
chr7 (187-293)||(2662943-2663046)
chr7 (204-279)||(19266489-19266564)
chr7 (217-296)||(27889320-27889399)
chr7 (214-296)||(18512457-18512539)
chr7 (187-289)||(23231579-23231681)
chr7 (204-290)||(35334826-35334912)
chr7 (187-235)||(46354216-46354264)
chr7 (188-235)||(16341301-16341348)
chr7 (214-296)||(11741842-11741924)
chr7 (614-668)||(22763439-22763493)
chr7 (222-296)||(47077859-47077933)
chr7 (187-290)||(21566457-21566561)
chr7 (660-715)||(4634017-4634072)
chr7 (187-254)||(14099052-14099119)
chr7 (187-254)||(14409069-14409136)
chr7 (225-296)||(23618981-23619052)
chr7 (205-295)||(25198766-25198856)
chr7 (187-253)||(48123531-48123597)
chr7 (187-275)||(7644978-7645066)
chr7 (263-296)||(36602545-36602578)
[»] chr5 (33 HSPs)
chr5 (190-290)||(16880657-16880757)
chr5 (187-296)||(38879603-38879714)
chr5 (187-296)||(24448912-24449021)
chr5 (189-288)||(7097772-7097870)
chr5 (187-296)||(32703446-32703553)
chr5 (187-296)||(41014341-41014449)
chr5 (187-296)||(20135626-20135737)
chr5 (187-296)||(27328774-27328885)
chr5 (187-290)||(29334417-29334521)
chr5 (187-290)||(43574628-43574731)
chr5 (187-296)||(4619108-4619219)
chr5 (187-296)||(13801771-13801882)
chr5 (187-287)||(19142956-19143055)
chr5 (187-296)||(7368420-7368527)
chr5 (187-296)||(8169988-8170095)
chr5 (187-296)||(35710335-35710442)
chr5 (188-277)||(2838802-2838890)
chr5 (187-296)||(43334224-43334335)
chr5 (225-296)||(16957374-16957445)
chr5 (214-296)||(34154818-34154900)
chr5 (187-289)||(12006339-12006443)
chr5 (199-280)||(22600488-22600569)
chr5 (180-280)||(24323725-24323825)
chr5 (180-280)||(24360349-24360449)
chr5 (246-301)||(25622541-25622596)
chr5 (207-293)||(9794385-9794471)
chr5 (187-286)||(22187307-22187408)
chr5 (187-284)||(28516449-28516547)
chr5 (246-300)||(39801597-39801651)
chr5 (180-259)||(41425963-41426042)
chr5 (250-296)||(29184065-29184111)
chr5 (205-290)||(3771379-3771464)
chr5 (216-288)||(12477132-12477205)
[»] scaffold0258 (1 HSPs)
scaffold0258 (187-296)||(13028-13136)
[»] scaffold0057 (3 HSPs)
scaffold0057 (187-296)||(46853-46962)
scaffold0057 (190-286)||(24786-24882)
scaffold0057 (180-287)||(43674-43780)
[»] scaffold0049 (1 HSPs)
scaffold0049 (187-296)||(58999-59110)
[»] scaffold0311 (1 HSPs)
scaffold0311 (189-287)||(10834-10932)
[»] scaffold0015 (1 HSPs)
scaffold0015 (187-296)||(48638-48745)
[»] scaffold0180 (1 HSPs)
scaffold0180 (214-296)||(24137-24219)
[»] scaffold0168 (1 HSPs)
scaffold0168 (187-296)||(30601-30708)
[»] scaffold0018 (1 HSPs)
scaffold0018 (196-301)||(72866-72971)
[»] scaffold0954 (1 HSPs)
scaffold0954 (187-289)||(3566-3668)
[»] scaffold0223 (1 HSPs)
scaffold0223 (187-288)||(11153-11252)
[»] scaffold0187 (2 HSPs)
scaffold0187 (187-296)||(10054-10161)
scaffold0187 (187-296)||(20382-20489)
[»] scaffold0167 (1 HSPs)
scaffold0167 (189-280)||(23623-23714)
[»] scaffold1176 (1 HSPs)
scaffold1176 (207-288)||(1599-1680)
[»] scaffold0036 (1 HSPs)
scaffold0036 (207-269)||(35048-35110)


Alignment Details
Target: chr6 (Bit Score: 588; Significance: 0; HSPs: 29)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 588; E-Value: 0
Query Start/End: Original strand, 8 - 721
Target Start/End: Complemental strand, 13628543 - 13627835
Alignment:
8 tgttctaggtgtatttactacaagagacaagtaaaattttattctcttttattgacattgtttttgtacgttacggtatctcttcatagacccttttcat 107  Q
    ||||||||||||||||||||||||||||||||| |||||||||||| |||||||      ||||||||||||||||||||| ||||||||||||||||||    
13628543 tgttctaggtgtatttactacaagagacaagtataattttattctcctttattg------tttttgtacgttacggtatcttttcatagacccttttcat 13628450  T
108 acaattgttttacaagcctttccttatttggttcccgtatgacccatgattttagataactaagattgactaaagttccggaaacagcctcttgtttaaa 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13628449 acaattgttttacaagcctttccttatttggttcccgtatgacccatgattttagataactaagattgactaaagttccggaaacagcctcttgtttaaa 13628350  T
208 aaa-caaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttgttaat 306  Q
    ||| ||||||||   |||||||||||||||||||||  ||||||||||  |||   |||||||||||||| |||||||||| |||||||| |||||||||    
13628349 aaaacaaggtaaaattgcgtacaatacactaaatagcaagaccccttcctagactctgcgtatgcgggagttttagtgcactggattgccctttgttaat 13628250  T
307 actgcattgcatttttgtacctcacaataaccaccactttaatttcctttactgttatcatacgtttctacttctcctgatattgttctaagttccttta 406  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13628249 actacattgcatttttgtacctcacaataaccaccactttaatttcctttactgttatcatacgtttctacttctcctgatattgttctaagttccttta 13628150  T
407 aaaccctagtagcctacaccaacaaatagaattaagccattatcaccatctttcaaatagtttcaaaatcttattctaaacttgtgtagcttcgaagttt 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13628149 aaaccctagtagcctacaccaacaaatagaattaagccattatcaccatctttcaaatagtttcaaaatcttattctaaacttgtgtagcttcgaagttt 13628050  T
507 gaatccttccactattgcaagcaatttgtgcggctttgtagtgtgctgctgttaggagggaagtgcctaaggtaaggcttttttcccatacatttttacc 606  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13628049 gaattcttccactattgcaagcaatttgtgcggctttgtagtgtgctgctgttaggagggaagtgcctaaggtaaggcttttttcccatacatttttacc 13627950  T
607 aaatgctaaattgatattgaatctcaaaagggtgctctacataaaaaatttggcaaagattcatacttgtgtttttcttgcataatgtcaaattttatgt 706  Q
    || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||   ||||    
13627949 aagtgctaaattgatattgaatctcaaaagggtgctctacataataaatttggcaaagattcatatttgtgtttttcttgcataatgtcaaataaaatgt 13627850  T
707 ttaatagtcatttcg 721  Q
    |||||||||||||||    
13627849 ttaatagtcatttcg 13627835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 29355970 - 29355859
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||| ||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || | ||||||||||||||||||||||    
29355970 ggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 29355871  T
285 caccggattgcc 296  Q
    |||||| |||||    
29355870 caccgggttgcc 29355859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 12222030 - 12221918
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagc-tttagt 283  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || | ||||||||||||||| ||||||    
12222030 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagt 12221931  T
284 gcaccggattgcc 296  Q
    ||||||| |||||    
12221930 gcaccgggttgcc 12221918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 1354868 - 1354761
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
1354868 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 1354771  T
287 ccggattgcc 296  Q
    |||| |||||    
1354770 ccgggttgcc 1354761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 1346986 - 1347093
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||| ||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
1346986 ggaaacagccacttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 1347083  T
287 ccggattgcc 296  Q
    |||| |||||    
1347084 ccgggttgcc 1347093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 189 - 289
Target Start/End: Original strand, 1941879 - 1941979
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    ||||| |||||||| ||||||||| ||||||||||||||||||||||  ||| ||| |||||| ||   ||||||| ||||||||||| ||| |||||||    
1941879 aaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccatcctggatcttgtgtatgcgggagtttttgtgcacc 1941978  T
289 g 289  Q
    |    
1941979 g 1941979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 26097182 - 26097289
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| ||||   | ||||||||| | || | ||| |||||||||||| |||||||    
26097182 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagtgca 26097279  T
287 ccggattgcc 296  Q
    |||| |||||    
26097280 ccgggttgcc 26097289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 223 - 296
Target Start/End: Complemental strand, 383837 - 383764
Alignment:
223 gcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||||||| |||| ||| |||||||||||||| | ||||||||||||||||| ||| |||||| |||||    
383837 gcgtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcc 383764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 287
Target Start/End: Complemental strand, 7947485 - 7947384
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||| |||| ||| |||||| || ||||||||||||||||||||| | |||| ||| | ||||||| | || |||||||||| ||||||||||||||    
7947485 ggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggaccttgcgtatgtgggagctttagtgc 7947386  T
286 ac 287  Q
    ||    
7947385 ac 7947384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 187 - 288
Target Start/End: Original strand, 9161145 - 9161247
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| |||||| ||  ||||||||||||||||||||  ||  || ||| ||||||||||| || | ||||||||||| ||||||||||    
9161145 ggaaacagcctcttgtgtaaaaa-cagagtaaggctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtg 9161243  T
285 cacc 288  Q
    ||||    
9161244 cacc 9161247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 237 - 296
Target Start/End: Complemental strand, 3116192 - 3116133
Alignment:
237 aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||| ||| ||||||||||| || ||||||||||||||||||||||| ||||||||||||    
3116192 aaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgcc 3116133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 25557747 - 25557854
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| ||||   |  |||||||| | || | ||| |||||||||||| |||||||    
25557747 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagtgca 25557844  T
287 ccggattgcc 296  Q
    |||| |||||    
25557845 ccgggttgcc 25557854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 283
Target Start/End: Original strand, 32579448 - 32579543
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagt 283  Q
    ||||||||||||| || ||||||  | |||||| ||||||||||||| | |||| ||| ||||||||| |||| | ||| |||||||||||||||||    
32579448 ggaaacagcctctggtataaaaat-acggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcgggagctttagt 32579543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 188 - 235
Target Start/End: Original strand, 6024256 - 6024303
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac 235  Q
    ||||||||||||||| ||||||||| |||||| |||||||||||||||    
6024256 gaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacac 6024303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 18277306 - 18277203
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || ||||||| || |||||  |||| |||| ||| |||||||||  |||   | ||||||||||||||||| ||||    
18277306 ggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggaccccttcctagactctacgtatgcgggagctttactgca 18277207  T
287 ccgg 290  Q
    ||||    
18277206 ccgg 18277203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 187 - 289
Target Start/End: Complemental strand, 23930238 - 23930138
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| ||| ||| ||||||||||| ||  | |||||||||||||| | || ||| ||||||||| | || | ||| ||||||||||||||||||||    
23930238 ggaaacagtctcatgtgtaaaaaacaagata--gttgcgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgca 23930141  T
287 ccg 289  Q
    |||    
23930140 ccg 23930138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 233
Target Start/End: Original strand, 8409265 - 8409311
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatac 233  Q
    |||||| ||||||||| ||||||||| ||||||||||||||||||||    
8409265 ggaaactgcctcttgtgtaaaaaacagggtaaggctgcgtacaatac 8409311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 221 - 296
Target Start/End: Original strand, 12885967 - 12886044
Alignment:
221 ctgcgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||||||||| ||| |  ||| ||||||||| |||| | |||||||| ||||||||||||||||||| |||||    
12885967 ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgcc 12886044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 289
Target Start/End: Original strand, 33138855 - 33138957
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| |||||||||  ||||||| ||||||||||||| |||| ||| ||||| ||  | || | || |||||| | ||||||||||||    
33138855 ggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtatgcagtagctttagtgca 33138954  T
287 ccg 289  Q
    |||    
33138955 ccg 33138957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 296
Target Start/End: Original strand, 17432395 - 17432479
Alignment:
214 ggtaaggctgcgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||| ||||||||||||||| |  ||||||||  ||| | |||| || | ||||||||||||||||||||||| |||||    
17432395 ggtaaggctgtgtacaatacactaaaaatggtgagaccttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgcc 17432479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 287
Target Start/End: Complemental strand, 23240935 - 23240837
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || ||||||  ||||||||||| || || | ||| ||||||||||  ||   ||||||||||||||||||||||||    
23240935 ggaaacagcctcttgtgtaaaa--cagggtaagtttgcgtacaatataccaattggtgggaccccttctaggacaatgcgtatgcgggagctttagtgca 23240838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 288
Target Start/End: Complemental strand, 32728269 - 32728169
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||| | ||||||||| |||||| ||| |||||||| || |||||||| | ||| ||| |||| | | ||||||||||| ||||||||||    
32728269 ggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaaatagtg-gtccctttcccagaccctacgtatgcgggaactttagtgca 32728171  T
287 cc 288  Q
    ||    
32728170 cc 32728169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 198 - 300
Target Start/End: Complemental strand, 24751176 - 24751068
Alignment:
198 cttgtttaaaaaacaaggtaaggctgcgtacaatacact-aaatagtgagaccccttctcagatcttgcgtatgcg-----ggagctttagtgcaccgga 291  Q
    ||||| ||||||| | |||||| |||||||||||||||| |||| ||||||||||||| |  | | ||||||||||     | ||||||||||||||||     
24751176 cttgtgtaaaaaatagggtaagactgcgtacaatacactaaaatggtgagaccccttcacgaaccgtgcgtatgcgtatgagcagctttagtgcaccggg 24751077  T
292 ttgccattt 300  Q
    |||||||||    
24751076 ttgccattt 24751068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 3815190 - 3815087
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| || |||| ||||||| | |||| | ||||||||||||||| |||| ||| ||||| ||| |  | | | ||||||||| ||||||||||||    
3815190 ggaaacagactattgtgtaaaaaatatggtacgactgcgtacaatacaccaaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgca 3815091  T
287 ccgg 290  Q
    ||||    
3815090 ccgg 3815087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 254
Target Start/End: Original strand, 12228380 - 12228447
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttc 254  Q
    |||||||| ||||||||||||||| | | ||| | |||||||||||||| | |||||| |||||||||    
12228380 ggaaacagactcttgtttaaaaaataggataaagttgcgtacaatacaccagatagtgggaccccttc 12228447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 242
Target Start/End: Original strand, 20400689 - 20400744
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatag 242  Q
    |||||||  ||||||| ||||||||| |||||| ||||||||| ||||||||||||    
20400689 ggaaacaatctcttgtgtaaaaaacagggtaagactgcgtacagtacactaaatag 20400744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 284
Target Start/End: Original strand, 24097608 - 24097696
Alignment:
192 cagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||||||| ||||||||| ||||||||||| ||||    || |||| ||| ||||||||| | || | ||||||||||| ||||||||||    
24097608 cagcctcttgtataaaaaacagggtaaggctgcttaca----accaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtg 24097696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 287
Target Start/End: Complemental strand, 15866150 - 15866052
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||||||||   ||||||||| ||||| |||||||  ||||||| |||| ||| ||||||||| | || | ||||| ||||||| || |||||||    
15866150 ggaaacagcctcttaagtaaaaaacagggtaaagctgcgt--aatacaccaaatggtgggaccccttcccggaccctgcgtttgcgggatctatagtgca 15866053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Complemental strand, 30786411 - 30786378
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
30786411 tgcgtatgcgggagctttagtgcaccgggttgcc 30786378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 70; Significance: 3e-31; HSPs: 49)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 11514458 - 11514566
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||||||| ||||||||||||||||||||| |||| ||| || |||||| |||| | ||||||||||||||||||||||||    
11514458 ggaaacagcctcttgtgtaaaaaacaaagtaaggctgcgtacaatacaccaaatggtggga-cccttcccagaccctgcgtatgcgggagctttagtgca 11514556  T
287 ccggattgcc 296  Q
    ||||||||||    
11514557 ccggattgcc 11514566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 8455429 - 8455320
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||| ||| |||||||||||||||||||||| |||| ||| ||||||||| | || | ||||||||| ||||||||||||||    
8455429 ggaaacagcctcttgtgtaaaacacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgccggagctttagtgca 8455330  T
287 ccggattgcc 296  Q
    |||| |||||    
8455329 ccgggttgcc 8455320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 9671203 - 9671310
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||||||||||||||||||||||||    
9671203 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 9671300  T
287 ccggattgcc 296  Q
    |||| |||||    
9671301 ccgggttgcc 9671310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 10546184 - 10546294
Alignment:
187 ggaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||| |||||||| ||||||| || |||||||||||||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||    
10546184 ggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc 10546283  T
286 accggattgcc 296  Q
    ||||| |||||    
10546284 accgggttgcc 10546294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 187 - 301
Target Start/End: Original strand, 10543720 - 10543836
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||| ||||||||| ||||||||| ||||||||||||||||||||||   |||| ||| ||||||||| | || | ||||||||||||||||||||||    
10543720 ggaaacggcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 10543819  T
285 caccggattgccatttg 301  Q
    |||||| ||||| ||||    
10543820 caccgggttgccctttg 10543836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 14530340 - 14530451
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| ||||||||| |||||||||||| |  ||| ||| ||||||||| | || | ||||||||||||||||||||||    
14530340 ggaaacagcctcttgtataaaaaacagggtaaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 14530439  T
285 caccggattgcc 296  Q
    |||||| |||||    
14530440 caccgggttgcc 14530451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 36871515 - 36871622
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| | |||| || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||||||||||||||||||||||||    
36871515 ggaaacagcctcttgtgtgaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagctttagtgca 36871612  T
287 ccggattgcc 296  Q
    |||| |||||    
36871613 ccgggttgcc 36871622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 186 - 280
Target Start/End: Complemental strand, 32781402 - 32781308
Alignment:
186 cggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttt 280  Q
    |||||||| |||||||| ||||||||| |||||| ||||||||||||||| |||| ||| ||||||||| |||| | || |||||||||||||||    
32781402 cggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgggagcttt 32781308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 187 - 301
Target Start/End: Complemental strand, 40762347 - 40762233
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||||  ||||||||| |||||||||||| |||| ||| ||||| |||   || | |||||||| |||||||||||||||    
40762347 ggaaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgca 40762248  T
287 ccggattgccatttg 301  Q
    |||| ||||| ||||    
40762247 ccgggttgccctttg 40762233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 188 - 284
Target Start/End: Complemental strand, 99375 - 99281
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||  |||||||| || ||||||||||||||||||| |||| |||  ||||||||||||| | || |||||||||||||||||||    
99375 gaaacagcctcttgt--aaaaaacatggcaaggctgcgtacaatacaccaaatggtggaaccccttctcagaccctgtgtatgcgggagctttagtg 99281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 288
Target Start/End: Original strand, 14444751 - 14444851
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || |||||||||| |||| |||||| |||| ||| ||||||||| | || | ||||||||||||||||||||||||    
14444751 ggaaacagcctcttgtgtaaaaa-cagggtaaggctgtgtacgatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 14444849  T
287 cc 288  Q
    ||    
14444850 cc 14444851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 188 - 303
Target Start/End: Complemental strand, 25079830 - 25079714
Alignment:
188 gaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||| |||||||| ||||||| |||||||||| ||||||||||||||  ||| ||| ||||||||| | || | |||||||||  |||||||||||||    
25079830 gaaacaacctcttgtgtaaaaaaacaaggtaaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgca 25079731  T
287 ccggattgccatttgtt 303  Q
    |||| ||||| ||||||    
25079730 ccgggttgccctttgtt 25079714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 180 - 307
Target Start/End: Complemental strand, 19977834 - 19977707
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctt 279  Q
    |||||| |||||||||||||| | ||||||| | | ||||| |||||||||||||| |||| ||| || |||||| |  | |||| ||||||||||||||    
19977834 aagttctggaaacagcctcttttgtaaaaaataggataaggttgcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctt 19977735  T
280 tagtgcaccggattgccatttgttaata 307  Q
    ||||||||| |||| || ||| ||||||    
19977734 tagtgcaccagattacccttttttaata 19977707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 218 - 296
Target Start/End: Complemental strand, 24860070 - 24859992
Alignment:
218 aggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||| |||| ||   |||||||||| || | ||||||||||||||||||||||||||||||||||    
24860070 aggctgcgtacaatacaccaaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgcc 24859992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 195 - 296
Target Start/End: Original strand, 17668032 - 17668133
Alignment:
195 cctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattg 294  Q
    |||||||| |||||| || |||||||||||||||||||||| |||| |||  ||||||||||  | | |||||||  ||||||||||||||||||| |||    
17668032 cctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttg 17668131  T
295 cc 296  Q
    ||    
17668132 cc 17668133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 188 - 296
Target Start/End: Original strand, 17623587 - 17623695
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    |||||| |||||||| |||||| || |||||||||||||||||||||| |||| |||  |||||||| |  ||| |||||||| || |||||||||||||    
17623587 gaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcac 17623686  T
288 cggattgcc 296  Q
     || |||||    
17623687 tgggttgcc 17623695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 24200738 - 24200627
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| ||||||||||||||||||||||   |||| ||| || |||||| | || | || ||||| | |||||||||||    
24200738 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtg 24200639  T
285 caccggattgcc 296  Q
    |||||| |||||    
24200638 caccgggttgcc 24200627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 188 - 286
Target Start/End: Original strand, 17896282 - 17896381
Alignment:
188 gaaacagcctcttgtttaaaaaacaagg-taaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||| |||||||| |||||||  ||| ||||||||||||||||| || |||| ||| ||||||||||| || | |||||||| |||||||||||||||    
17896282 gaaacaacctcttgtgtaaaaaaatagggtaaggctgcgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgca 17896381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 188 - 290
Target Start/End: Complemental strand, 4516463 - 4516361
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||||||||||||| ||||||||| || || |||||||||||||||| || | ||| ||||||||| | || | |||||||| || |||||||||| ||    
4516463 gaaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaattggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtac 4516364  T
288 cgg 290  Q
    |||    
4516363 cgg 4516361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 191 - 296
Target Start/End: Complemental strand, 21779368 - 21779265
Alignment:
191 acagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||||||||| |||||  || ||||||| |||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||||||    
21779368 acagcctcttgtgtaaaa--cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg 21779271  T
291 attgcc 296  Q
     |||||    
21779270 gttgcc 21779265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 23397788 - 23397895
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||| |   ||||||||| |||||||||||| |||| ||| ||||||||||| || | | | |||||||||||| |||||||    
23397788 ggaaacagcctcttgtgtaaaatag--ggtaaggctacgtacaatacaccaaatggtgggaccccttctcggaccctacatatgcgggagctctagtgca 23397885  T
287 ccggattgcc 296  Q
    |||| |||||    
23397886 ccgggttgcc 23397895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 205 - 287
Target Start/End: Original strand, 24890451 - 24890533
Alignment:
205 aaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    |||||||||||||||||||| |||||||||| || | ||| ||||||||| | || | ||||||||| |||||||||||||||    
24890451 aaaaaacaaggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac 24890533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 25249850 - 25249742
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| ||||||| || ||| || |||||||||||||||||||||| |||| ||| || |||||| |  | | |||||||||| |||||||||||||    
25249850 ggaaacagtctcttgtgtacaaa-cagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgca 25249752  T
287 ccggattgcc 296  Q
    |||| |||||    
25249751 ccgggttgcc 25249742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 204 - 301
Target Start/End: Original strand, 25632548 - 25632645
Alignment:
204 taaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttg 301  Q
    ||||||||| | |||||||||||||||||||| |||| ||| ||  ||||| |  | ||| |||||||||||||||||||||||||| ||||| ||||    
25632548 taaaaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccctttg 25632645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 205 - 294
Target Start/End: Complemental strand, 26684715 - 26684626
Alignment:
205 aaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattg 294  Q
    |||||| | ||||||||||||||||||| ||||||| ||| |||| |||| |  | | ||||||||||||||||||| ||||||||||||    
26684715 aaaaaatatggtaaggctgcgtacaatatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattg 26684626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 205 - 290
Target Start/End: Original strand, 44643563 - 44643648
Alignment:
205 aaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    ||||||||  |||||||||||||||||  || |||| ||| ||||||||| |||| | ||||||||||||||| ||||||||||||    
44643563 aaaaaacagagtaaggctgcgtacaatgtaccaaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgg 44643648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 187 - 288
Target Start/End: Original strand, 7214556 - 7214659
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||| ||||||| ||||| ||| ||||||||||||||||||||||   |||| |||||| |||||||| ||   |||||||||| ||| |||||||    
7214556 ggaaacagtctcttgtgtaaaatacagggtaaggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtg 7214655  T
285 cacc 288  Q
    ||||    
7214656 cacc 7214659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 12024031 - 12023929
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || |||||||||||||||||||||| |||| ||| |||||| || | || | |||||||  || ||||||| ||||    
12024031 ggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccctcccggaccctgcgtatttggaagctttaatgca 12023933  T
287 ccgg 290  Q
    ||||    
12023932 ccgg 12023929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 207 - 294
Target Start/End: Original strand, 25641543 - 25641630
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattg 294  Q
    |||||| ||||| | |||||||||||||| |||| ||| ||||||||| |  ||| |||||||||| ||||||||||| |||||||||    
25641543 aaaacagggtaaagttgcgtacaatacaccaaattgtgggaccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattg 25641630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 187 - 294
Target Start/End: Original strand, 30826059 - 30826164
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||  | ||||||| |||||||||||||| |||| ||| || |||||| |||| | | | ||||||||||||||||||||    
30826059 ggaaacagcctcttgtgtaaaaat-agggtaaggttgcgtacaatacaccaaatggtg-gaacccttcccagaccctacatatgcgggagctttagtgca 30826156  T
287 ccggattg 294  Q
    || |||||    
30826157 ccagattg 30826164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 180 - 285
Target Start/End: Complemental strand, 15296527 - 15296421
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagct 278  Q
    |||| ||||||||||||| |||| ||||| ||| ||||||||||||||||||| | | |||||||| || |||||||| || | |||||||| || ||||    
15296527 aagtcccggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaaaatagtgggatcccttctcggaccctgcgtatgtggaagct 15296428  T
279 ttagtgc 285  Q
    || ||||    
15296427 ttggtgc 15296421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 39914419 - 39914310
Alignment:
187 ggaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||| |||||||| ||||||| || ||||||| || |||||||||||  ||| ||| ||||||||| | || | |||||||||||||||||||||||    
39914419 ggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccgaatggtgggaccccttc-ctgaccctgcgtatgcgggagctttagtgc 39914321  T
286 accggattgcc 296  Q
    | ||| |||||    
39914320 atcgggttgcc 39914310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 189 - 294
Target Start/End: Complemental strand, 31158552 - 31158445
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||  ||||||||| ||||||  ||| ||||||| || ||| |  ||| ||||||||| |||| | ||||||||||||||||||||| ||    
31158552 aaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtaca 31158453  T
287 ccggattg 294  Q
    || |||||    
31158452 cctgattg 31158445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 214 - 294
Target Start/End: Complemental strand, 39499316 - 39499236
Alignment:
214 ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattg 294  Q
    ||||| |||||||||||||||  |||| ||| || ||||| ||  ||| |||||||||||||||||||||||||| |||||    
39499316 ggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcaccagattg 39499236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 188 - 288
Target Start/End: Original strand, 19615015 - 19615116
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    |||||| |||||||| ||||||||| |||||| |||||||||||| || |  ||||||| ||||||||| |  | | ||||||||| |||||||||||||    
19615015 gaaacatcctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagtg-gaccccttcccgaaccctgcgtatgcaggagctttagtgc 19615113  T
286 acc 288  Q
    |||    
19615114 acc 19615116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 214 - 284
Target Start/End: Complemental strand, 13245181 - 13245111
Alignment:
214 ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| |||||||||| ||| ||||||||| | || | ||| ||| ||||||||||||||    
13245181 ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgcatatacgggagctttagtg 13245111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 281
Target Start/End: Complemental strand, 44521486 - 44521392
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttta 281  Q
    |||||||  ||||||| ||||||||||||||||||||| || ||||||| |||| | | || |||||| ||||  |||| ||| |||||||||||    
44521486 ggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacaccaaatggcgggagcccttcccagacattgcatatacgggagcttta 44521392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 203 - 296
Target Start/End: Complemental strand, 12315749 - 12315656
Alignment:
203 ttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||| |||||| ||| ||||||||||| |||||||||||| |||||  |||   | |||||||| ||| ||||||| | |||||||||    
12315749 ttaaaaaacagggtaagactgtgtacaatacaccaaatagtgagactccttcctagactatacgtatgcgagagttttagtgtatcggattgcc 12315656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 291
Target Start/End: Original strand, 17471571 - 17471676
Alignment:
188 gaaacagcctcttgtttaaaaaacaagg-taaggctgcgtacaatacactaaatag-tgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||||||||||| |||||||  ||| |||| |||||||||||| || |||  | |||||||||||| | || | ||| |||||||||| ||||||||    
17471571 gaaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgc 17471670  T
286 accgga 291  Q
    ||||||    
17471671 accgga 17471676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 254
Target Start/End: Original strand, 22371079 - 22371143
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttc 254  Q
    |||||||||||| |||   ||||||| |||||||||||||||||||||| |||| ||| |||||||||    
22371079 ggaaacagcctcgtgt---aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttc 22371143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 280
Target Start/End: Original strand, 33795300 - 33795400
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaa-tacactaaatagtgagaccccttctcagatcttgcgtatgcgggagct 278  Q
    |||| ||||||||| |||||||  ||||||||| ||||||||||||||||| |||||  | | ||| ||||||||| |||| | || |||||||||||||    
33795300 aagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacaccta-tggtgggaccccttcccagaccctgtgtatgcgggagct 33795398  T
279 tt 280  Q
    ||    
33795399 tt 33795400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 187 - 254
Target Start/End: Original strand, 5450307 - 5450375
Alignment:
187 ggaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacactaaatagtgagaccccttc 254  Q
    ||||||| |||||||| ||||||| || |||||||||||||||||||||| |||  ||| |||||||||    
5450307 ggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagggtgggaccccttc 5450375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 660 - 715
Target Start/End: Complemental strand, 19569648 - 19569593
Alignment:
660 caaagattcatacttgtgtttttcttgcataatgtcaaattttatgtttaatagtc 715  Q
    |||| ||||||| |||||||||||||||| ||||||||||   |||||||||||||    
19569648 caaaaattcatatttgtgtttttcttgcacaatgtcaaatgaaatgtttaatagtc 19569593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 263 - 301
Target Start/End: Complemental strand, 124951 - 124913
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgccatttg 301  Q
    |||||||||||||||||||||||||||| ||||| ||||    
124951 tgcgtatgcgggagctttagtgcaccgggttgccttttg 124913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 189 - 235
Target Start/End: Complemental strand, 23145809 - 23145763
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac 235  Q
    |||||| ||||||| |||||||||  |||||||||||||||||||||    
23145809 aaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacac 23145763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 189 - 235
Target Start/End: Complemental strand, 23557599 - 23557553
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac 235  Q
    |||||| ||||||| |||||||||  |||||||||||||||||||||    
23557599 aaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacac 23557553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 190 - 296
Target Start/End: Original strand, 27573646 - 27573751
Alignment:
190 aacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccg 289  Q
    ||||||||||||| || ||| || |||||||||||||||||||||| |||| |||  |||  ||| || | | || ||||| ||||||||||||||| ||    
27573646 aacagcctcttgtgtataaa-catggtaaggctgcgtacaatacaccaaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcg 27573744  T
290 gattgcc 296  Q
    | |||||    
27573745 ggttgcc 27573751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 187 - 293
Target Start/End: Complemental strand, 30864529 - 30864424
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||  | ||||||| ||||||||||| || |||| || ||| || ||| || | | ||||||||||| |||||  |||||    
30864529 ggaaacagcctcttgtgtaaaaat-agggtaagggtgcgtacaatataccaaatggtaagatcctttcccaaaccctgcgtatgcggaagcttcggtgca 30864431  T
287 ccggatt 293  Q
    |||||||    
30864430 ccggatt 30864424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Original strand, 22371210 - 22371243
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
22371210 tgcgtatgcgggagctttagtgcaccgggttgcc 22371243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 69; Significance: 1e-30; HSPs: 41)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 187 - 295
Target Start/End: Complemental strand, 29521798 - 29521690
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||| || ||| || |||| | ||||||||||||||||||||||||    
29521798 ggaaacagcctcttgtttaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgca 29521699  T
287 ccggattgc 295  Q
    |||| ||||    
29521698 ccgggttgc 29521690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 180 - 296
Target Start/End: Original strand, 45071280 - 45071395
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctt 279  Q
    |||||| |||||||||||||||| |||||| || |||||||||||||||||||||| |||| ||| ||||||||| | || |||||||||||||||||||    
45071280 aagttctggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagctt 45071378  T
280 tagtgcaccggattgcc 296  Q
     |||||||||| |||||    
45071379 cagtgcaccgggttgcc 45071395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 28817739 - 28817630
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||||| ||||||||||||||||||||||  ||| ||| ||||||||| | || | ||||||||||||||||||||||||    
28817739 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 28817640  T
287 ccggattgcc 296  Q
     ||| |||||    
28817639 tcgggttgcc 28817630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 187 - 288
Target Start/End: Original strand, 36720818 - 36720919
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |||| ||| ||||||||| | || | ||||||||||| ||||||||||||    
36720818 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgca 36720917  T
287 cc 288  Q
    ||    
36720918 cc 36720919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 61; E-Value: 8e-26
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 39461109 - 39460998
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| |||||||||  ||||||||||||||||||||| |  ||| ||||||||||||| | || | ||||||||||||||||||||||    
39461109 ggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtg 39461010  T
285 caccggattgcc 296  Q
    |||||| |||||    
39461009 caccgggttgcc 39460998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 44530171 - 44530274
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||||||| |||||||||||||||||||||| |||| ||| |||||||||   || | ||||||||||||||||||||||||    
44530171 ggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgca 44530270  T
287 ccgg 290  Q
    ||||    
44530271 ccgg 44530274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 187 - 305
Target Start/End: Original strand, 35261701 - 35261819
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| ||||||| ||||||||| ||||||| |||||||||||||| |||| ||| |||||||||   || | ||||||||||||||||||||||||    
35261701 ggaaacagtctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgca 35261800  T
287 ccggattgccatttgttaa 305  Q
    |||| ||||| ||| ||||    
35261801 ccgggttgcccttttttaa 35261819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 187 - 288
Target Start/End: Original strand, 29877116 - 29877217
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||||| |||| ||||||||| |||||||||||||||||||||| |||| ||| ||||||||| | || | ||||||||||||||| ||||||||    
29877116 ggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgca 29877215  T
287 cc 288  Q
    ||    
29877216 cc 29877217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 6760844 - 6760955
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| ||||||||| |||||||||||| |  ||| ||| ||||||||||| || |  || ||||||||||||||||||    
6760844 ggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtg 6760943  T
285 caccggattgcc 296  Q
    |||||| |||||    
6760944 caccgggttgcc 6760955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 188 - 296
Target Start/End: Original strand, 13160725 - 13160832
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||||||||||||| |||||| || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||||||||||||||||| ||||| |    
13160725 gaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgc 13160823  T
288 cggattgcc 296  Q
    ||| |||||    
13160824 cgggttgcc 13160832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 8484051 - 8483948
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||||||| || ||||||||||||||||||| || | ||| |||||| || |||| | |||||||||||||||||||| |||    
8484051 ggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaattggtgggaccccatcccagaccctgcgtatgcgggagctttagggca 8483952  T
287 ccgg 290  Q
    ||||    
8483951 ccgg 8483948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 30454208 - 30454101
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  |||||||||||||||||| |||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
30454208 ggaaacagcctcttgtgtaaaa--caaggtaaggctgcgtacgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 30454111  T
287 ccggattgcc 296  Q
    |||| |||||    
30454110 ccgggttgcc 30454101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 26954154 - 26954266
Alignment:
187 ggaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagt 283  Q
    |||||||||||||||| ||||||| || |||||||||||||||||||||| |  ||| ||| ||||||||| |||| || || |||||||||||||||||    
26954154 ggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagt 26954253  T
284 gcaccggattgcc 296  Q
    |||| || |||||    
26954254 gcactgggttgcc 26954266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 12670361 - 12670260
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
12670361 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 12670264  T
287 ccgg 290  Q
    ||||    
12670263 ccgg 12670260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 187 - 301
Target Start/End: Original strand, 2626541 - 2626658
Alignment:
187 ggaaacagcctcttgtttaaaaaacaa---ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagt 283  Q
    |||||||||||||||| ||||||| ||   |||||| ||||||||||||||| ||||  || ||||||||| |||| | ||| ||||||||||||| |||    
2626541 ggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacaccaaatgatgggaccccttcccagaccctgcatatgcgggagcttcagt 2626640  T
284 gcaccggattgccatttg 301  Q
    ||||| ||||||| ||||    
2626641 gcaccagattgccctttg 2626658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 5135402 - 5135300
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||| | |||||||||| ||||||||||| |||| ||| ||||||||| | || | ||||||||| |||||||| |||||    
5135402 ggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagcttt-gtgca 5135304  T
287 ccgg 290  Q
    ||||    
5135303 ccgg 5135300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 193 - 295
Target Start/End: Original strand, 5689659 - 5689761
Alignment:
193 agcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggat 292  Q
    |||||||||| |||||| || |||||||||||||||||||||| |||| |||  |||||||| |  | | |||||||| ||||||||||||||||||| |    
5689659 agcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtt 5689758  T
293 tgc 295  Q
    |||    
5689759 tgc 5689761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 10857850 - 10857960
Alignment:
187 ggaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    |||||| ||||||||| ||||||| || |||||||||||| ||||||||| || | ||| |||| ||||   || |||||||||||||||||||||||||    
10857850 ggaaaccgcctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgc 10857949  T
286 accggattgcc 296  Q
    ||||| |||||    
10857950 accgggttgcc 10857960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 12625911 - 12626021
Alignment:
187 ggaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||| |||||||| ||||||| || |||||| |||| |||||||||| |||| ||| |||||| || | || | |||||||||||||||||||||||    
12625911 ggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacaccaaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgc 12626010  T
286 accggattgcc 296  Q
    ||||| |||||    
12626011 accgggttgcc 12626021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 187 - 300
Target Start/End: Complemental strand, 18164872 - 18164760
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || ||||||| |||||||||||||| |||   || ||||  ||| | || | ||||||||||||||||||||||||    
18164872 ggaaacagcctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaaaggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgca 18164774  T
287 ccggattgccattt 300  Q
    |||| |||||||||    
18164773 ccgggttgccattt 18164760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 20284186 - 20284079
Alignment:
187 ggaaacagcctcttgtttaaaaaacaa--ggtaaggctgcgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagctttag 282  Q
    |||||||||||||||| ||||||| ||  |||||||||||||||||||||| ||  || ||| ||||||||| | || | |||||||||||||| |||||    
20284186 ggaaacagcctcttgtataaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttag 20284087  T
283 tgcaccgg 290  Q
    ||||||||    
20284086 tgcaccgg 20284079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 187 - 288
Target Start/End: Original strand, 22598179 - 22598279
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||||||| |||||||||  ||||||||||| || | ||||||||| ||| | || ||||||||||||||| ||||||||||    
22598179 ggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaattggtgagaccctttcccggaccttgcgtatgcggga-ctttagtgca 22598277  T
287 cc 288  Q
    ||    
22598278 cc 22598279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 20869945 - 20870056
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||| ||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| |||||||||   || |  || ||||||||||||||||||    
20869945 ggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtg 20870044  T
285 caccggattgcc 296  Q
    |||||| |||||    
20870045 caccgggttgcc 20870056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 21070815 - 21070707
Alignment:
187 ggaaacagcctcttgtttaaaaaacaa---ggtaaggctgcgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagcttta 281  Q
    |||||||||||||||| ||||||| ||   |||||||||||||||||||||| ||  || ||| ||||||||| | || | |||||||||||||| ||||    
21070815 ggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagtttta 21070716  T
282 gtgcaccgg 290  Q
    |||||||||    
21070715 gtgcaccgg 21070707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 7136642 - 7136537
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||| |||||||| |||||| || |||||||||||||||||||||| |  ||| ||| ||||||||| | || |  || ||||||||||||||||||    
7136642 ggaaacaacctcttgtgtaaaaaccagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 7136543  T
285 caccgg 290  Q
    ||||||    
7136542 caccgg 7136537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 188 - 289
Target Start/End: Complemental strand, 24365172 - 24365071
Alignment:
188 gaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||||||||| ||||||| || |||||||||||| ||||||||| |||| ||| ||||||||| | || | |||||||| ||||||||| |||||    
24365172 gaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtgggagcttt-gtgca 24365074  T
287 ccg 289  Q
    |||    
24365073 ccg 24365071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 288
Target Start/End: Complemental strand, 8897877 - 8897776
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| || ||||| ||||||| | ||||||||| |||||||||||| |||| ||| ||||||||| | || | ||| ||||||||||||||| ||||    
8897877 ggaaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactgca 8897778  T
287 cc 288  Q
    ||    
8897777 cc 8897776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 217 - 296
Target Start/End: Original strand, 31457224 - 31457303
Alignment:
217 aaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||||||||||||  |||| ||  ||||||||| || | | |||||||||||||||| |||||||||||||||||    
31457224 aaggctgcgtacaatacatcaaatggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgcc 31457303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 290
Target Start/End: Complemental strand, 44742639 - 44742528
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagct 278  Q
    |||||| |||||||  ||| ||| ||||||||| ||||||||||||||||||||| | |||| ||| ||||||||||  || | | || ||||||||||     
44742639 aagttctggaaacaatctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcttggaccctacggatgcgggagca 44742540  T
279 ttagtgcaccgg 290  Q
    ||||||||||||    
44742539 ttagtgcaccgg 44742528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 187 - 287
Target Start/End: Complemental strand, 44781619 - 44781517
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||| |||||||| ||||| ||| |||||||||| |||||||||||   ||||  || |||||| || |||| | ||||||||||||||||||||||    
44781619 ggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtg 44781520  T
285 cac 287  Q
    |||    
44781519 cac 44781517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 187 - 293
Target Start/End: Original strand, 389665 - 389773
Alignment:
187 ggaaacagcctcttgttt--aaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||| |||||||| |  |||||||| ||||||| |||||||||||||| ||||  || || |||||  | || | |||||||||| |||||||||||    
389665 ggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgaccctgcgtatgcgagagctttagtg 389764  T
285 caccggatt 293  Q
    |||||||||    
389765 caccggatt 389773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 17823598 - 17823707
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || | |||| ||||||| ||||||| |||| |||  |||||||| |  | | ||| ||||| ||||||||||||||    
17823598 ggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaaatacaccaaatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgca 17823697  T
287 ccggattgcc 296  Q
    |||| |||||    
17823698 ccgggttgcc 17823707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 207 - 296
Target Start/End: Original strand, 19729382 - 19729471
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||| |||||||||| ||||||||||| |||| ||| ||||||||| | || | ||| ||| |||||||| |||||||| ||||||||    
19729382 aaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgcc 19729471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 214 - 290
Target Start/End: Original strand, 26457778 - 26457852
Alignment:
214 ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||||||||||||||||||| || | ||| ||||||| ||  || |||||||||| |||||||||||||||||||    
26457778 ggtaaggctgcgtacaatacaccaattggtgggacccctcct--gaccttgcgtatgagggagctttagtgcaccgg 26457852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 222 - 290
Target Start/End: Original strand, 16013511 - 16013581
Alignment:
222 tgcgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||||||||||||||| |  ||| ||||||||| |||| | ||| ||||||||||||||||||||||||    
16013511 tgcgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgg 16013581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 240
Target Start/End: Complemental strand, 14018082 - 14018029
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaat 240  Q
    |||||||| ||||||| ||||||||| ||| || ||||||||||||||||||||    
14018082 ggaaacagtctcttgtgtaaaaaacagggtgagactgcgtacaatacactaaat 14018029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 664 - 721
Target Start/End: Complemental strand, 15151370 - 15151313
Alignment:
664 gattcatacttgtgtttttcttgcataatgtcaaattttatgtttaatagtcatttcg 721  Q
    |||| ||||||||||| |||||||||||||||||||   ||||||||||||| |||||    
15151370 gatttatacttgtgttcttcttgcataatgtcaaatgaaatgtttaatagtcttttcg 15151313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 664 - 715
Target Start/End: Complemental strand, 16822060 - 16822009
Alignment:
664 gattcatacttgtgtttttcttgcataatgtcaaattttatgtttaatagtc 715  Q
    ||||||||||||||||||||||| | ||||||||||   |||||||||||||    
16822060 gattcatacttgtgtttttcttgtacaatgtcaaatgaaatgtttaatagtc 16822009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 226 - 296
Target Start/End: Original strand, 26102578 - 26102648
Alignment:
226 tacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| |||||    
26102578 tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgcc 26102648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 189 - 235
Target Start/End: Original strand, 43942348 - 43942394
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac 235  Q
    |||||||||||| | | ||||||| ||||||||||||||||||||||    
43942348 aaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacac 43942394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Complemental strand, 27468129 - 27468096
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
27468129 tgcgtatgcgggagctttagtgcaccgggttgcc 27468096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 69; Significance: 1e-30; HSPs: 52)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 187 - 295
Target Start/End: Complemental strand, 23768433 - 23768325
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |||| ||| ||| ||||| |||| | ||||||||||||||||||||||||    
23768433 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgca 23768334  T
287 ccggattgc 295  Q
     ||||||||    
23768333 gcggattgc 23768325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 46248066 - 46247957
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||||| |||||| ||||||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||| |    
46248066 ggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgta 46247967  T
287 ccggattgcc 296  Q
    |||| |||||    
46247966 ccgggttgcc 46247957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 23796510 - 23796613
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| ||| |||||| |||||||||||||| |||| ||||||||||||| |||| | ||| ||||| ||||||||||||||    
23796510 ggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagtgca 23796609  T
287 ccgg 290  Q
    ||||    
23796610 ccgg 23796613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 204 - 296
Target Start/End: Original strand, 4349700 - 4349792
Alignment:
204 taaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||| |||||||||||||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||||| |||||    
4349700 taaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 4349792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 10668270 - 10668381
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||||||||||| |||||||||||||| |  ||| ||| ||||||||| | |  | ||||||||||||||||||||||    
10668270 ggaaacagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtg 10668369  T
285 caccggattgcc 296  Q
    |||||| |||||    
10668370 caccgggttgcc 10668381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 20004205 - 20004094
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||||||||| || |||||||||||||||||||||||||||||||| |  ||| ||| ||||||||| |||| |  || ||||||||||||||||||    
20004205 ggaaacagcctctcgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg 20004106  T
285 caccggattgcc 296  Q
    |||||| |||||    
20004105 caccgggttgcc 20004094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 194 - 296
Target Start/End: Complemental strand, 1517418 - 1517315
Alignment:
194 gcctcttgt-ttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggat 292  Q
    ||||||||| |||||||||| | |||||||||||||||||||| || | ||| |||||||||||||| | ||||||||| |||||||||||||||||| |    
1517418 gcctcttgtgttaaaaaacatgataaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggt 1517319  T
293 tgcc 296  Q
    ||||    
1517318 tgcc 1517315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 14617083 - 14617186
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||| |||||||||||| |||||||||||||| |||| ||| || |||||| | || | ||| ||||||||||||||||||||    
14617083 ggaaacagcctcttgtgtaaataacaaggtaaggttgcgtacaatacaccaaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgca 14617182  T
287 ccgg 290  Q
    ||||    
14617183 ccgg 14617186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 34725209 - 34725102
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || ||||||||||||||||||||||||||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
34725209 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 34725112  T
287 ccggattgcc 296  Q
    |||| |||||    
34725111 ccgggttgcc 34725102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 18944688 - 18944800
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagc-tttagt 283  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || | ||||||||||||||| ||||||    
18944688 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagt 18944787  T
284 gcaccggattgcc 296  Q
    ||||||| |||||    
18944788 gcaccgggttgcc 18944800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 27474326 - 27474434
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| ||||||| |||||| || || || ||||||||||||||||| ||| ||| ||||||||| | || | ||||||||||||||||||||||||    
27474326 ggaaacagtctcttgtgtaaaaa-cagggcaaagctgcgtacaatacactgaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 27474424  T
287 ccggattgcc 296  Q
    ||||||||||    
27474425 ccggattgcc 27474434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 188 - 296
Target Start/End: Complemental strand, 35253297 - 35253191
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||    
35253297 gaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac 35253200  T
288 cggattgcc 296  Q
    |||||||||    
35253199 cggattgcc 35253191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 46991849 - 46991958
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||||||| |||||||||| |||||||||||  ||| ||| ||||||||| | || | |||||||| |||||||||||||||    
46991849 ggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgca 46991948  T
287 ccggattgcc 296  Q
    |||| |||||    
46991949 ccgggttgcc 46991958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 188 - 307
Target Start/End: Complemental strand, 38478392 - 38478275
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||||||||||||| |||||  || |||||||||||||||||||||| |||| |||  |||||||||| || | ||| |||||||||||| ||||||||    
38478392 gaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcac 38478295  T
288 cggattgccatttgttaata 307  Q
    ||| ||||| ||| ||||||    
38478294 cgggttgcccttttttaata 38478275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 187 - 286
Target Start/End: Original strand, 27201692 - 27201793
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| | | ||||| ||||||||||||||||||||||   |||| ||| ||||||||| | || ||||||||||||||||||||||||    
27201692 ggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtg 27201791  T
285 ca 286  Q
    ||    
27201792 ca 27201793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 189 - 296
Target Start/End: Original strand, 35005170 - 35005279
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||| ||||||||| ||||||||||| ||||||||||   |||| ||| ||||||||| | || | |||||||||||| |||||||||||    
35005170 aaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgca 35005269  T
287 ccggattgcc 296  Q
    |||| |||||    
35005270 ccgggttgcc 35005279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 289
Target Start/End: Complemental strand, 30395841 - 30395737
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || |  || ||||||||||||||||||    
30395841 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 30395742  T
285 caccg 289  Q
    |||||    
30395741 caccg 30395737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 288
Target Start/End: Complemental strand, 32632669 - 32632569
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || |||||||||||||||||||||| |||| ||| ||||||||| || | | ||| ||||||||||||| ||||||    
32632669 ggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgca 32632571  T
287 cc 288  Q
    ||    
32632570 cc 32632569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 207 - 290
Target Start/End: Complemental strand, 10378828 - 10378745
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||| |||||||||||||||||||||| |||| ||| ||||||||||  || | ||| ||||||||||||||||||||||||    
10378828 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgg 10378745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 221 - 296
Target Start/End: Original strand, 45402175 - 45402250
Alignment:
221 ctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||||||||| |||| ||| ||||||||| |||| | |||||||||||||||||||||||||||| |||||    
45402175 ctgcgtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgcc 45402250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 187 - 293
Target Start/End: Original strand, 47214556 - 47214660
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| |||||||||||||  || ||||||| |||||||||||||| |||| ||| ||||||||| |||| | ||| |||||||||||| |||||||    
47214556 ggaaacagtctcttgtttaaaa--cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgcgggagctctagtgca 47214653  T
287 ccggatt 293  Q
    || ||||    
47214654 ccagatt 47214660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 289
Target Start/End: Original strand, 6925145 - 6925247
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||| |||||||||| ||||||| | |||||||||||| |||||||||  ||| ||| ||||||||| | |  | ||||||||||||||||||||||||    
6925145 ggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccgaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgca 6925244  T
287 ccg 289  Q
    |||    
6925245 ccg 6925247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 180 - 287
Target Start/End: Complemental strand, 12126955 - 12126850
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctt 279  Q
    |||||| ||||||||| |||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| ||||||||||||     
12126955 aagttctggaaacagcttcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaattgtgggaccccttcccggaccctgcatatgcgggagctg 12126858  T
280 tagtgcac 287  Q
    ||||||||    
12126857 tagtgcac 12126850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 205 - 290
Target Start/End: Complemental strand, 18742054 - 18741967
Alignment:
205 aaaaaacaaggtaaggctgcgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||||| |||||||||||||||||||||| ||| |  ||| ||||||||| |||| | |||||||||| |||||||||||||||||    
18742054 aaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgg 18741967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 180 - 291
Target Start/End: Complemental strand, 27136772 - 27136660
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagct 278  Q
    |||||| || |||| |||||||| ||||||||| ||||||| ||||||||||||| | |||| ||| |||||||||  ||||| || |||||||||||||    
27136772 aagttctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaaaatggtgggaccccttcctagatcatgtgtatgcgggagct 27136673  T
279 ttagtgcaccgga 291  Q
      |||||||||||    
27136672 ccagtgcaccgga 27136660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 9939506 - 9939612
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgaga-ccccttctcagatcttgcgtatgcgggagctttagt 283  Q
    ||||||| |||||||||||| ||||| ||||||| ||||| ||||||||   |||| ||| || ||||||||| || | |||||||||||||||||||||    
9939506 ggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagctttagt 9939605  T
284 gcaccgg 290  Q
    |||||||    
9939606 gcaccgg 9939612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 188 - 286
Target Start/End: Complemental strand, 17470458 - 17470361
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||||||||| ||||||||| ||||||||||||||||||||| | |||||||| ||||| ||| | || | |||||||| |||||||||||||||    
17470458 gaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatagtgggacccgttc-ctga-cctgcgtatgtgggagctttagtgca 17470361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 44485222 - 44485120
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| || ||||| ||||| ||| |||||||||||||||||||||| |||| ||  ||||||||| | |||| | |||||||||||||||| |||||    
44485222 ggaaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacaccaaatggttggaccccttcccggatcctacgtatgcgggagcttt-gtgca 44485124  T
287 ccgg 290  Q
    ||||    
44485123 ccgg 44485120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 194 - 296
Target Start/End: Original strand, 8197095 - 8197197
Alignment:
194 gcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggatt 293  Q
    ||||||||| ||||||||| ||||||||| |||||| ||||| |||| ||  ||||||||||| || | ||||||||  |||||||||||| ||||| ||    
8197095 gcctcttgtgtaaaaaacatggtaaggctacgtacagtacaccaaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggtt 8197194  T
294 gcc 296  Q
    |||    
8197195 gcc 8197197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 288
Target Start/End: Complemental strand, 45264513 - 45264411
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaa-tagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||| ||||||||  ||||||||  ||||||||| || |||||||| ||| | ||| |||||||||||||| | ||| |||||||||||||||||||    
45264513 ggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctcagaccctgcatatgcgggagctttagtgc 45264414  T
286 acc 288  Q
    |||    
45264413 acc 45264411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 280
Target Start/End: Complemental strand, 18724658 - 18724565
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttt 280  Q
    |||||||||||||||| ||||||||| |||||||||| ||||||||||| ||||  || ||||||||| | || | | | ||||||||||||||    
18724658 ggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaatcttgggaccccttcccggaccctacatatgcgggagcttt 18724565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 31382326 - 31382218
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || | |||||||||||||||||||| |||| ||| |||||||||   || | ||| ||||||||||||||| || |    
31382326 ggaaacagcctcttgtgtaaaaa-caggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttactgta 31382228  T
287 ccggattgcc 296  Q
    |||| |||||    
31382227 ccgggttgcc 31382218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 206 - 296
Target Start/End: Complemental strand, 42304303 - 42304211
Alignment:
206 aaaaacaaggtaaggctgcgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||| ||||||| |||||||||||||| ||| |  ||| ||||||||| | || | |||||||| |||||||||||||||||||||||||    
42304303 aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcc 42304211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 189 - 288
Target Start/End: Original strand, 19701617 - 19701717
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    |||||||||||||| ||||||||  ||||||| || |||||||||| | |||| ||| | ||||||| | || | |||||||||||||||||||||||||    
19701617 aaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcac 19701716  T
288 c 288  Q
    |    
19701717 c 19701717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 660 - 715
Target Start/End: Original strand, 23971075 - 23971130
Alignment:
660 caaagattcatacttgtgtttttcttgcataatgtcaaattttatgtttaatagtc 715  Q
    ||||||||||||||||||||||||||||| ||||||||||   |||||||||||||    
23971075 caaagattcatacttgtgtttttcttgcacaatgtcaaatgaaatgtttaatagtc 23971130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 25468376 - 25468285
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagct 278  Q
    ||||||| |||||||| |||||| || ||||||| |||||||||||||| |||| ||  |||| |||| |||| | ||||||||||||||||    
25468376 ggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatggttggacctcttcccagaccctgcgtatgcgggagct 25468285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 187 - 254
Target Start/End: Complemental strand, 41319919 - 41319852
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttc 254  Q
    |||||||| ||||||| ||||||||| |||||||||||||||||||||| ||||  || |||||||||    
41319919 ggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttc 41319852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 208 - 290
Target Start/End: Original strand, 43768205 - 43768287
Alignment:
208 aaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    ||||| ||||||||||| |||||||||| || | ||| ||||||||| |||| | ||||||| ||||||||||| ||||||||    
43768205 aaacagggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgg 43768287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 214 - 296
Target Start/End: Complemental strand, 45812623 - 45812541
Alignment:
214 ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||||| |||||||||| |||| ||| ||||||||| || | | ||| |||||||||||| ||||||||||| |||||    
45812623 ggtaaggctgcatacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcc 45812541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 207 - 296
Target Start/End: Original strand, 19414502 - 19414591
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||| | |||||||||||||||||||| |||| ||| ||||||||| |  | | ||| |||||||||||| ||||||||||| |||||    
19414502 aaaacaggttaaggctgcgtacaatacaccaaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgcc 19414591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 193 - 290
Target Start/End: Complemental strand, 20999957 - 20999860
Alignment:
193 agcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||| ||||| |||||||||||| ||||||||||||||||||| ||||  || | |||||||    | | |||||| |||||||||||||||||||||    
20999957 agccacttgtgtaaaaaacaaggcaaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgg 20999860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 280
Target Start/End: Original strand, 11596559 - 11596650
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttt 280  Q
    |||||| |||||||| |||||| || |||||||||||||| ||||||| |||| ||| |||||||||   || | ||||||||||||||||||    
11596559 gaaacaacctcttgtgtaaaaa-cagggtaaggctgcgtataatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttt 11596650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 189 - 300
Target Start/End: Original strand, 35019277 - 35019387
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    ||||| |||||||| |||||| ||   ||||||||| |||||||||| || | ||| ||||||| | |||| | |||||||||| |||||||||||||||    
35019277 aaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaattggtgggacccctcc-cagaccctgcgtatgcgagagctttagtgcacc 35019375  T
289 ggattgccattt 300  Q
    ||  ||||||||    
35019376 gggctgccattt 35019387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 6983922 - 6983821
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||||||  || ||||||||| ||||||  |||||||||||||| |||| ||| ||||||||  | || | |||||| || |||||||| |||||    
6983922 ggaaacagcctc--gtataaaaaacagggtaagtatgcgtacaatacaccaaatggtgggacccctttccggaccctgcgtaggcaggagctttggtgca 6983825  T
287 ccgg 290  Q
    ||||    
6983824 ccgg 6983821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 39215072 - 39214968
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaata-cactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||| |||||||| ||||||||  |||||||||||||||||||   | |||| ||| | ||||||| || | | |||||||| || |||||||||||    
39215072 ggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaatggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgc 39214973  T
286 accgg 290  Q
    |||||    
39214972 accgg 39214968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 289
Target Start/End: Original strand, 15505636 - 15505710
Alignment:
214 ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccg 289  Q
    |||||| ||||||||||||||| |||| ||| ||||||||| |  | | |||||||||||||||||| ||||||||    
15505636 ggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccg 15505710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 15511264 - 15511158
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcg--tacaatacactaaa-tagtgagaccccttctcagatcttgcgtatgcgggagctttagt 283  Q
    |||||| ||||||||| ||||||||| ||||||||||||  |||||||||| ||| | |||  ||||||||   || | |||||||| | ||||||||||    
15511264 ggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacaccaaaatggtggtaccccttcctggaccctgcgtatgtgtgagctttagt 15511165  T
284 gcaccgg 290  Q
    |||||||    
15511164 gcaccgg 15511158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 254
Target Start/End: Complemental strand, 34149073 - 34149006
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttc 254  Q
    |||||||||||||||| || |||| | ||||||| ||||||||| | || |||| |||||||||||||    
34149073 ggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccccttc 34149006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 35117881 - 35117775
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgt-atgcgggagctttagt 283  Q
    ||||| |||||||||| ||||| ||| |||||||||| |||||||||||   ||||  || ||||||||| | || | ||||| |||| |||||||||||    
35117881 ggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagctttagt 35117782  T
284 gcaccgg 290  Q
    |||||||    
35117781 gcaccgg 35117775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 205 - 290
Target Start/End: Original strand, 46859129 - 46859215
Alignment:
205 aaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||||| |||||| |||||||||||||| | |||| ||| ||| | || ||||  |||||||||| ||||| |||||||||||||    
46859129 aaaaaacagggtaagactgcgtacaatacaccaaaatggtgggactcattttcaggccttgcgtatgtgggagttttagtgcaccgg 46859215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 229
Target Start/End: Original strand, 25027989 - 25028030
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtaca 229  Q
    ||||||||||||||| |||||||| |||||||||||| ||||    
25027989 gaaacagcctcttgtgtaaaaaacgaggtaaggctgcataca 25028030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 246 - 287
Target Start/End: Complemental strand, 33594185 - 33594144
Alignment:
246 gaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||||||| |||| | |||||||||||||||||||||||||    
33594185 gaccccttcccagaccctgcgtatgcgggagctttagtgcac 33594144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 67; Significance: 2e-29; HSPs: 60)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 54484734 - 54484844
Alignment:
187 ggaaacagcctcttgtttaaaa-aacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    |||||||||||||||| ||||| ||||||||||||||||||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||    
54484734 ggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc 54484833  T
286 accggattgcc 296  Q
    ||||| |||||    
54484834 accgggttgcc 54484844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 40272925 - 40272816
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||||||| |||||||||||||||||||||| |||| ||| ||||||||| | || | ||||||||||||||||||||||||    
40272925 ggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 40272826  T
287 ccggattgcc 296  Q
    |||| |||||    
40272825 ccgggttgcc 40272816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 12914148 - 12914039
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||||| |||||||| ||||||||||||| |||| ||||||||||||| |||| | ||| ||||||||||||| | ||||    
12914148 ggaaacagcctcttgtgtaaaaaacagggtaaggcggcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgca 12914049  T
287 ccggattgcc 296  Q
    |||| |||||    
12914048 ccgggttgcc 12914039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 22609810 - 22609918
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || |||||||||||||||||||||| |||| ||| ||||||||| | || ||||||||||||||||||| ||||||    
22609810 ggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgca 22609908  T
287 ccggattgcc 296  Q
    |||| |||||    
22609909 ccgggttgcc 22609918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 61; E-Value: 8e-26
Query Start/End: Original strand, 189 - 289
Target Start/End: Complemental strand, 6411932 - 6411833
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    |||||||||||||| |||||| || |||||||||||||||||||||| ||||  || ||||||||| |||| ||||||||||||||||||||||||||||    
6411932 aaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcacc 6411834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 13628905 - 13628794
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||| ||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || | ||||||||||||||||||||||    
13628905 ggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 13628806  T
285 caccggattgcc 296  Q
    |||||| |||||    
13628805 caccgggttgcc 13628794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 45948951 - 45948848
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||||| | ||||||||||| |||||||||| || | ||| ||||||||||| || | ||||||||||||||||||||||||    
45948951 ggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaattggtgggaccccttctcggaccctgcgtatgcgggagctttagtgca 45948852  T
287 ccgg 290  Q
    ||||    
45948851 ccgg 45948848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 14987001 - 14987106
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||| ||| | || ||||| ||||||||||||||||||    
14987001 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttagtg 14987100  T
285 caccgg 290  Q
    ||||||    
14987101 caccgg 14987106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 25517284 - 25517174
Alignment:
187 ggaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||| |||||||| ||||||| |||| || ||||||||||||||||| |||| ||| ||||||||| | |||| ||||||||| |||||||||||||    
25517284 ggaaacatcctcttgtgtaaaaaaacaagatatggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgc 25517185  T
286 accggattgcc 296  Q
    ||||| |||||    
25517184 accgggttgcc 25517174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 287
Target Start/End: Complemental strand, 34420757 - 34420656
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    |||||||||||||||| ||||||||| ||||||||||||||| ||||| | |||| ||| ||||||||| | || |||||||||| ||||||||||||||    
34420757 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaatggtgggaccccttcccggaccttgcgtatgtgggagctttagtgc 34420658  T
286 ac 287  Q
    ||    
34420657 ac 34420656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 188 - 296
Target Start/End: Original strand, 39203561 - 39203667
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||||||||||||| |||||  || ||||||| |||||||||||||| |||| ||| ||||||||| | || ||||| |||||||||||||||||||||    
39203561 gaaacagcctcttgtgtaaaa--cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcac 39203658  T
288 cggattgcc 296  Q
    ||| |||||    
39203659 cgggttgcc 39203667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 46421150 - 46421038
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagcttt-agt 283  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || | |||||||||||||||||| |||    
46421150 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagt 46421051  T
284 gcaccggattgcc 296  Q
    ||||||| |||||    
46421050 gcaccggtttgcc 46421038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 29366835 - 29366724
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || | |||||||| |||||||||||||    
29366835 ggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtg 29366736  T
285 caccggattgcc 296  Q
    ||| || |||||    
29366735 cactgggttgcc 29366724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 187 - 307
Target Start/End: Complemental strand, 49013588 - 49013466
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || |  || || |||||||||||||||    
49013588 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtg 49013489  T
285 caccggattgccatttgttaata 307  Q
    |||||| ||||| ||| ||||||    
49013488 caccgggttgcccttttttaata 49013466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 189 - 296
Target Start/End: Complemental strand, 45786327 - 45786218
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||| ||||||||| ||||||||||||||||||||||   |||| ||| ||||||||| | || | |||| |||| ||||||||||||||    
45786327 aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca 45786228  T
287 ccggattgcc 296  Q
    |||| |||||    
45786227 ccgggttgcc 45786218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 7943034 - 7943143
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||| |||||| ||||||||| |||||| ||||||||||||||  |||| ||| || |||||  |||| | ||||||||||||||||||||||||    
7943034 ggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgggatccctttccagaccatgcgtatgcgggagctttagtgca 7943133  T
287 ccggattgcc 296  Q
    | || |||||    
7943134 ctgggttgcc 7943143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 288
Target Start/End: Original strand, 26573171 - 26573272
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||| ||| ||||||||| |||||||||||||||||||||| || | ||| |||||| || | || | |||||||||| |||||||||||||    
26573171 ggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgca 26573270  T
287 cc 288  Q
    ||    
26573271 cc 26573272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 26869751 - 26869859
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||||||| || |||||| || |||||||||||||||||||||| |||| ||| ||||||||  | || | |||||||||||||||||| |||||    
26869751 ggaaacagcctctggtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgca 26869849  T
287 ccggattgcc 296  Q
    |||| |||||    
26869850 ccgggttgcc 26869859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 13730717 - 13730606
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| |||||||||| ||||||||||| |  ||| ||| ||||||||| | || |  || ||||||||||||||||||    
13730717 ggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 13730618  T
285 caccggattgcc 296  Q
    |||||| |||||    
13730617 caccgggttgcc 13730606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 187 - 301
Target Start/End: Original strand, 31592893 - 31593005
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||| ||||| | || | ||| |||||||||||| |||||||    
31592893 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcgggagctctagtgca 31592990  T
287 ccggattgccatttg 301  Q
    |||| ||||| ||||    
31592991 ccgggttgccctttg 31593005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 516453 - 516565
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaata---cactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagt 283  Q
    |||||||||||||||| ||||||||| |||||||||||| ||||||   ||  |||| | | ||||||||| | || | |||||||||||||||||||||    
516453 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcgggaccccttccccgaccctgcgtatgcgggagctttagt 516552  T
284 gcaccggattgcc 296  Q
    ||||||| |||||    
516553 gcaccgggttgcc 516565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 1217134 - 1217241
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| |||| | | ||||||||| | || | ||| |||||||||||| |||||||    
1217134 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgca 1217231  T
287 ccggattgcc 296  Q
    |||| |||||    
1217232 ccgggttgcc 1217241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 288
Target Start/End: Complemental strand, 31904970 - 31904868
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagacccc-ttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||||||| || | ||||||||| |||| | ||||||||||||||| |||| ||| |||||| ||| |||||||| ||| |||||||||||||||||    
31904970 ggaaacagcctattatgtaaaaaacagggtatgactgcgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagctttagtgc 31904871  T
286 acc 288  Q
    |||    
31904870 acc 31904868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 187 - 288
Target Start/End: Complemental strand, 10795538 - 10795435
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||| ||| ||||||||||||||||||||||   |||| ||| |||||||||   || | ||||||||||||||||| ||||    
10795538 ggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtg 10795439  T
285 cacc 288  Q
    ||||    
10795438 cacc 10795435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 53996679 - 53996575
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||| |||||||| ||||||||| ||||||||||| ||||||||| | |||| ||| ||||||||| | ||   |||||||| ||||||||||||||    
53996679 ggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaatggtgggaccccttccctgacactgcgtatgtgggagctttagtgc 53996580  T
286 accgg 290  Q
    |||||    
53996579 accgg 53996575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 19731046 - 19731149
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||| |||||||||| ||||||||||||||||| ||||||||||||||  | | ||| ||||| ||| ||||   || |||||| ||||||||||||||    
19731046 ggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactctgtgtatgcaggagctttagtgca 19731145  T
287 ccgg 290  Q
    ||||    
19731146 ccgg 19731149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 207 - 290
Target Start/End: Complemental strand, 34771457 - 34771374
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||| |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||||||    
34771457 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg 34771374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 22123028 - 22122921
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| ||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||| ||||| |||||||    
22123028 ggaaacagtctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgca 22122931  T
287 ccggattgcc 296  Q
    |||| |||||    
22122930 ccgggttgcc 22122921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 189 - 290
Target Start/End: Original strand, 55401222 - 55401324
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    |||||||||||||| ||||||||| | |||| ||||||| |||||| | |||| ||| ||||||||||| || ||| ||||||||||||||||  |||||    
55401222 aaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcgggagcttttttgcac 55401321  T
288 cgg 290  Q
    |||    
55401322 cgg 55401324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 281
Target Start/End: Complemental strand, 8247802 - 8247706
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagcttta 281  Q
    |||||||||||||||| ||||||||| ||||||| |||||||||||||| |  ||| ||| ||| ||||| | || | |||||||||||||||||||    
8247802 ggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagcttta 8247706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 192 - 281
Target Start/End: Original strand, 9276313 - 9276401
Alignment:
192 cagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttta 281  Q
    ||||||||||| ||||||||| |||||||||||||||||||||| |||| ||| ||||| ||| | || | ||||||||||||| |||||    
9276313 cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtg-gaccctttcccggaccctgcgtatgcgggaacttta 9276401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 207 - 296
Target Start/End: Original strand, 15797284 - 15797373
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||| |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||| ||||||| ||||||||||| |||||    
15797284 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcc 15797373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 215 - 296
Target Start/End: Complemental strand, 52926304 - 52926223
Alignment:
215 gtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||||||||||||||| |||| ||| ||| ||||| | || | |||||||||||||||||||| ||||||| |||||    
52926304 gtaaggctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcc 52926223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 188 - 296
Target Start/End: Original strand, 16735486 - 16735593
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    |||||||||||||||  ||||| || |||||||||||||||||||||| |||| ||| ||||||||| | ||   ||||||||||| ||||| |||||||    
16735486 gaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcac 16735584  T
288 cggattgcc 296  Q
     || |||||    
16735585 tgggttgcc 16735593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 193 - 288
Target Start/End: Original strand, 33235581 - 33235676
Alignment:
193 agcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    |||||||||| ||||||| || |||||| ||| |||||||||||||||| ||| |||||| || |||| ||| ||||||||| ||||||||||||||    
33235581 agcctcttgtgtaaaaaaacagggtaagactgtgtacaatacactaaatggtgggacccc-tcgcagaccttacgtatgcggaagctttagtgcacc 33235676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 52428590 - 52428480
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtg-------agaccccttctcagatcttgcgtatgcgggagctt 279  Q
    |||| ||||||||||| ||||| ||| |||||||||||||||||||||| ||||||||       | |||||||||| || | | |||||| ||||||||    
52428590 ggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccccaaaccccttctcggaccctacgtatgtgggagctt 52428491  T
280 tagtgcaccgg 290  Q
    |||||||||||    
52428490 tagtgcaccgg 52428480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 204 - 296
Target Start/End: Complemental strand, 353447 - 353353
Alignment:
204 taaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || |  || |||||||||||||||||||||||| |||||    
353447 taaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc 353353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 19751622 - 19751725
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||| |||||||||| |||||| |||||||||| ||||||||||||||  | | ||| ||||| ||| ||||  ||| ||||||  |||||||||||||    
19751622 ggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactttgtgtatgcatgagctttagtgca 19751721  T
287 ccgg 290  Q
    ||||    
19751722 ccgg 19751725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 288
Target Start/End: Original strand, 31672737 - 31672839
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagac-cccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||||||| || | |||||||||||| |||  |||||||||||||| |||| ||| ||| | |||| || ||||| ||| |||||||||||||||||    
31672737 ggaaacagcctattatgtaaaaaacaaggcaagagtgcgtacaatacaccaaatggtgggactctcttcccatatcttacgtgtgcgggagctttagtgc 31672836  T
286 acc 288  Q
    |||    
31672837 acc 31672839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 288
Target Start/End: Complemental strand, 54374459 - 54374357
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||| |||||||| ||||||| | |||||||||||||||||| || | |||| ||| ||||||||| | || | ||| ||||||||||||||||| |    
54374459 ggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagttc 54374360  T
286 acc 288  Q
    |||    
54374359 acc 54374357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 189 - 254
Target Start/End: Original strand, 47624088 - 47624152
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttc 254  Q
    |||||||||||||| |||||| || |||||||||||||||||||||| |||| ||| |||||||||    
47624088 aaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttc 47624152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 5173833 - 5173723
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||| |||||||| |||||| ||| |||||| ||| | |||||||| ||| |  ||| | ||||||| | || ||||||||||||||||||||||||    
5173833 ggaaacaacctcttgtgtaaaaa-caaagtaaggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtg 5173735  T
285 caccggattgcc 296  Q
    |||||| |||||    
5173734 caccgggttgcc 5173723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 235
Target Start/End: Complemental strand, 45620949 - 45620893
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacac 235  Q
    |||||| |||||||||||||||| ||||||| || ||||||||||||||||||||||    
45620949 aagttctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacac 45620893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 193 - 305
Target Start/End: Complemental strand, 4495771 - 4495671
Alignment:
193 agcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggat 292  Q
    ||||| |||| ||||||||| |||||||||||||||||||||| |||| ||| |||||            |||||||||||||||||||||||||||| |    
4495771 agcctattgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccc------------tgcgtatgcgggagctttagtgcaccgggt 4495684  T
293 tgccatttgttaa 305  Q
    |||| ||| ||||    
4495683 tgcccttttttaa 4495671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 187 - 283
Target Start/End: Original strand, 9607247 - 9607345
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagt 283  Q
    |||||||||||||||  ||||||||| |||||||||||||| ||||||| |  |||  || ||||||||| |||| |  || |||||||||||||||||    
9607247 ggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagctttagt 9607345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 21875057 - 21875112
Alignment:
187 ggaaacagcctcttgt-ttaaaaaacaaggtaaggctgcgtacaatacactaaata 241  Q
    ||||||| |||||||| |||||||| | ||||||||||||||||||||||||||||    
21875057 ggaaacaacctcttgtgttaaaaaagagggtaaggctgcgtacaatacactaaata 21875112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 660 - 714
Target Start/End: Original strand, 9021814 - 9021868
Alignment:
660 caaagattcatacttgtgtttttcttgcataatgtcaaattttatgtttaatagt 714  Q
    |||||||||||||||||||| |||||||| ||||||||||   ||||||||||||    
9021814 caaagattcatacttgtgttcttcttgcacaatgtcaaatgaaatgtttaatagt 9021868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 193 - 290
Target Start/End: Complemental strand, 44403663 - 44403565
Alignment:
193 agcctcttgtttaaaaaacaaggtaaggctgcgtacaata-cactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||||||| ||||| |||||||||||||||| | |||| ||| |||| ||| ||||||||| | || | | ||||||| | ||||||||||||||||    
44403663 agcctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgg 44403565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 45139591 - 45139488
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||| |||||||| ||||| ||| ||||||||||| ||||||||||   |||| ||| ||||||||| |||| | ||||||||||||| |||| |||    
45139591 ggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccaga-cctgcgtatgcgggaacttt-gtg 45139494  T
285 caccgg 290  Q
    ||||||    
45139493 caccgg 45139488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 225 - 306
Target Start/End: Original strand, 24577917 - 24577998
Alignment:
225 gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttgttaat 306  Q
    |||||||||||||||| ||| || || ||| |||| | ||| ||| |||||||| ||||||||||||||||| ||| |||||    
24577917 gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgcccttttttaat 24577998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 280
Target Start/End: Complemental strand, 30928260 - 30928167
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttt 280  Q
    |||||||||||||||| ||||||||||||||||| || ||| ||||||| || | | | ||||||||| | || | ||| |||| |||||||||    
30928260 ggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcgggaccccttcccggaccctgcatatgtgggagcttt 30928167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 187 - 235
Target Start/End: Complemental strand, 54032672 - 54032624
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac 235  Q
    ||||||| |||||||| ||||||||| ||||||||||| ||||||||||    
54032672 ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacac 54032624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 290
Target Start/End: Complemental strand, 829555 - 829452
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaa-tagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||| |||||||| |||| ||||  |||| | |||||||||||||| ||| | ||| ||||||||| |  | | ||||||||| ||||||||||||||    
829555 gaaacaacctcttgtctaaagaacatagtaaagttgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgca 829456  T
287 ccgg 290  Q
    ||||    
829455 ccgg 829452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 237 - 296
Target Start/End: Complemental strand, 24851364 - 24851305
Alignment:
237 aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||| ||| ||||||||| | |||| ||| |||||||||||||||||||||||| |||||    
24851364 aaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgcc 24851305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 187 - 288
Target Start/End: Original strand, 25944513 - 25944615
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    |||||| |||||| || ||||||||  || ||||||| |||||||||| | |||| ||| ||||||||| | || | |||||||| ||||||||||| ||    
25944513 ggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaaaatggtgggaccccttccctgaccctgcgtatgtgggagctttagcgc 25944612  T
286 acc 288  Q
    |||    
25944613 acc 25944615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 250 - 288
Target Start/End: Complemental strand, 31922889 - 31922851
Alignment:
250 ccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    ||||| |||||||| ||||||||||||||||||||||||    
31922889 ccttcccagatcttacgtatgcgggagctttagtgcacc 31922851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Complemental strand, 10484653 - 10484620
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
10484653 tgcgtatgcgggagctttagtgcaccgggttgcc 10484620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Original strand, 40390361 - 40390394
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
40390361 tgcgtatgcgggagctttagtgcaccgggttgcc 40390394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Original strand, 47624219 - 47624252
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
47624219 tgcgtatgcgggagctttagtgcaccgggttgcc 47624252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Complemental strand, 54032608 - 54032575
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
54032608 tgcgtatgcgggagctttagtgcaccgggttgcc 54032575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 63; Significance: 5e-27; HSPs: 58)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 20639772 - 20639662
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    |||||||||||||||| ||||||||| ||||||||||||||||||||| | |||| ||| ||||||||| | || | |||||||||||||||||||||||    
20639772 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc 20639673  T
286 accggattgcc 296  Q
    ||||| |||||    
20639672 accgggttgcc 20639662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 40915851 - 40915959
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||| |||||||||||||||||||||||||| |||| ||| || |||||| | || | ||||||||||||||||| ||||||    
40915851 ggaaacagcctcttgtgtaaaa-acaaggtaaggctgcgtacaatacaccaaatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgca 40915949  T
287 ccggattgcc 296  Q
    ||||||||||    
40915950 ccggattgcc 40915959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 189 - 296
Target Start/End: Complemental strand, 51865149 - 51865042
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    |||||||||||||| ||||||||| |||||||||||||||||||||| |||| ||| | ||||||| | || | ||||||||||||||||||| ||||||    
51865149 aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcacc 51865050  T
289 ggattgcc 296  Q
    ||| ||||    
51865049 ggactgcc 51865042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 5648281 - 5648389
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||||||||||||||||| ||||||    
5648281 ggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgca 5648379  T
287 ccggattgcc 296  Q
    | || |||||    
5648380 ctgggttgcc 5648389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 6430738 - 6430630
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || |||||||||||||||||||||| |||| ||| |||| |||| | || | |||||||||||||||||||| |||    
6430738 ggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgca 6430640  T
287 ccggattgcc 296  Q
    |||| |||||    
6430639 ccgggttgcc 6430630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 30639402 - 30639510
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| ||||||| |||||| || |||||||||||||||||||||| |||| ||||||||||||| | || | ||| ||||||||||||||||||||    
30639402 ggaaacagactcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgca 30639500  T
287 ccggattgcc 296  Q
    | || |||||    
30639501 ctgggttgcc 30639510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 188 - 284
Target Start/End: Original strand, 14983857 - 14983953
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||||||||||| ||||||| | ||||||| ||| ||||||||||||||| ||| ||||||||| | || | ||||||||||||||||||||||    
14983857 gaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 14983953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 187 - 281
Target Start/End: Complemental strand, 17043507 - 17043413
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttta 281  Q
    |||||||||||||||| ||||| ||| |||||||||||||||||||||| |||| ||| ||||||||| |||| | ||| ||||| |||||||||    
17043507 ggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgctggagcttta 17043413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 25629071 - 25629180
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| ||||||| ||||||| | |||||||||| ||||||||||| |||| ||| ||||||||| | || | | | ||||||||||||||||||||    
25629071 ggaaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgca 25629170  T
287 ccggattgcc 296  Q
    |||| |||||    
25629171 ccgggttgcc 25629180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 47443979 - 47444088
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||  ||||||||| |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| ||||| ||||||| ||||||    
47443979 ggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcaggagcttcagtgca 47444078  T
287 ccggattgcc 296  Q
    | || |||||    
47444079 ctgggttgcc 47444088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 187 - 291
Target Start/End: Original strand, 19027870 - 19027974
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| | |||||| ||||||||| |||||||||||||||||||||| || | ||| ||||||||  ||||   |||||||| |||||||||||||||    
19027870 ggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggacccctttccagactctgcgtatgtgggagctttagtgca 19027969  T
287 ccgga 291  Q
    |||||    
19027970 ccgga 19027974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 21646986 - 21647097
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||| | ||||||||||||||||||| || |  ||| ||| ||||||||| |||| |  || ||||||||||||||||||    
21646986 ggaaacagcctcttgtgtaaaaaatagggtaaggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg 21647085  T
285 caccggattgcc 296  Q
    |||||| |||||    
21647086 caccgggttgcc 21647097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 191 - 296
Target Start/End: Original strand, 23501813 - 23501920
Alignment:
191 acagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    |||||||||||| ||||||||| ||||||| |||||||||||||| |  ||| ||| ||||||||| | || | ||| ||||||||||||||||||||||    
23501813 acagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 23501912  T
289 ggattgcc 296  Q
    || |||||    
23501913 gggttgcc 23501920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 187 - 301
Target Start/End: Original strand, 20225006 - 20225118
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
20225006 ggaaacaacctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 20225103  T
287 ccggattgccatttg 301  Q
    |||| ||||| ||||    
20225104 ccgggttgccctttg 20225118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 35567192 - 35567295
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||| ||||| ||||||||| |||||||||| |||||| |||| |||| ||| ||||||||| |  | | ||||| ||||||||||||||||||    
35567192 ggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgca 35567291  T
287 ccgg 290  Q
    ||||    
35567292 ccgg 35567295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 48598936 - 48598829
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| ||||| |||||| |||||||    
48598936 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtgca 48598839  T
287 ccggattgcc 296  Q
    |||| |||||    
48598838 ccgggttgcc 48598829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 207 - 296
Target Start/End: Complemental strand, 29207991 - 29207902
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||| |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| ||||||||||| |||||    
29207991 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 29207902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 16408716 - 16408605
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| |||||| ||||||||||||||| |  ||| |||  |||||||| | || |  || ||||||||||||||||||    
16408716 ggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtg 16408617  T
285 caccggattgcc 296  Q
    |||||| |||||    
16408616 caccgggttgcc 16408605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 204 - 288
Target Start/End: Complemental strand, 30690272 - 30690188
Alignment:
204 taaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    ||||||||| ||||||||||| |||||||||| || | ||| ||||||||| | || | ||||||||||||||||||||||||||    
30690272 taaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcacc 30690188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 9987947 - 9987844
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| |||| || | ||||||||||| |||||||||| |||| ||| |||||||||   || ||||| ||||||||||||||| ||||    
9987947 ggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggagctttaatgca 9987848  T
287 ccgg 290  Q
    ||||    
9987847 ccgg 9987844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 193 - 296
Target Start/End: Complemental strand, 13256508 - 13256403
Alignment:
193 agcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||||||| ||||||||| |||||||||||||||||||||| |  ||||||| ||||||||| |  | |  || | ||||||||||||||||||||||    
13256508 agcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgg 13256409  T
291 attgcc 296  Q
     |||||    
13256408 gttgcc 13256403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 189 - 296
Target Start/End: Complemental strand, 44363243 - 44363134
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||| ||| ||||||||| |||| ||||||||||||  ||| ||| |  ||| ||||||||| | || | ||||||||||||||||||||||||    
44363243 aaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 44363144  T
287 ccggattgcc 296  Q
    |||| |||||    
44363143 ccgggttgcc 44363134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 47528641 - 47528534
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||  |||| ||||||| |||||||    
47528641 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgaatatgtgggagctctagtgca 47528544  T
287 ccggattgcc 296  Q
    |||| |||||    
47528543 ccgggttgcc 47528534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 208 - 290
Target Start/End: Complemental strand, 55766558 - 55766476
Alignment:
208 aaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    ||||| ||||||||||||||||||||||| ||| |||  ||||| || | || |||||||||||| |||||||||||||||||    
55766558 aaacagggtaaggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgg 55766476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 188 - 296
Target Start/End: Complemental strand, 10277867 - 10277761
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||||||||||||| ||||| |  |  |||||||||||||||||||| |||| |||| |||||||| |||| | ||| |||||||||| | ||||| ||    
10277867 gaaacagcctcttgtataaaatagga--taaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaac 10277770  T
288 cggattgcc 296  Q
    |||||||||    
10277769 cggattgcc 10277761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 287
Target Start/End: Complemental strand, 20908750 - 20908649
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||| | |||| | ||||||| ||||||||||||||||||||||| | |||| ||| ||||||||| |  | | |||||||||||||||||||||||    
20908750 ggaaacatcgtcttttctaaaaaagaaggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgc 20908651  T
286 ac 287  Q
    ||    
20908650 ac 20908649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 214 - 287
Target Start/End: Complemental strand, 41018880 - 41018807
Alignment:
214 ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||||||| |||||||||||| |||||||| ||||||||| |||| ||||||||||  || ||||||||||||    
41018880 ggtaaggctacgtacaatacaccaaatagtgggaccccttcccagaccttgcgtatggaggggctttagtgcac 41018807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 189 - 296
Target Start/End: Complemental strand, 9832422 - 9832317
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    |||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| ||||| ||| || |||||||||    
9832422 aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcaggaactctagtgcacc 9832325  T
289 ggattgcc 296  Q
    || |||||    
9832324 gggttgcc 9832317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 187 - 279
Target Start/End: Original strand, 49796820 - 49796911
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctt 279  Q
    |||||||||||||||| | |||| || |||||||||||||||||||||| |||| ||| ||||||||| |  | | |||||||||||||||||    
49796820 ggaaacagcctcttgtgttaaaa-catggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctt 49796911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 205 - 288
Target Start/End: Complemental strand, 12711544 - 12711461
Alignment:
205 aaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    |||||| | |||||| ||||||||||||||| |||| | | |||||||||||||| || |||||||||| | ||||||||||||    
12711544 aaaaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcacc 12711461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 188 - 296
Target Start/End: Original strand, 16911585 - 16911695
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    ||||||||||||||| || ||| || |||||||||||||||||||||| |  ||| ||| ||||||||| | || | |||||| ||||||||||||||      
16911585 gaaacagcctcttgtgtacaaatcagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagttt 16911684  T
286 accggattgcc 296  Q
    ||||| |||||    
16911685 accgggttgcc 16911695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 288
Target Start/End: Original strand, 25343202 - 25343312
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagc 277  Q
    |||||| ||||| || ||||||| ||||||||| |||||||||||||||||||||| ||| |  ||  |||||||||  ||||| |||||||| | ||||    
25343202 aagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaagggttggaccccttcctagatcctgcgtatgtgagagc 25343301  T
278 tttagtgcacc 288  Q
    ||||| |||||    
25343302 tttagagcacc 25343312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 189 - 290
Target Start/End: Original strand, 54175088 - 54175190
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagacccctt-ctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||| |||||| || ||||||||||||||||||||| | |||| ||| |||||||| | | || | ||| ||||||||||||||||||||    
54175088 aaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaaatggtgggaccccttccccggaccctgcatatgcgggagctttagtgca 54175186  T
287 ccgg 290  Q
    ||||    
54175187 ccgg 54175190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 7909393 - 7909284
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgc-gggagctttagtgc 285  Q
    |||||||| ||||||| |||||| || ||||||| |||||||||||||| |||| ||| ||||||||| |  | | ||||||||| ||||||||||||||    
7909393 ggaaacagtctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgc 7909295  T
286 accggattgcc 296  Q
    | ||| |||||    
7909294 atcgggttgcc 7909284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 215 - 289
Target Start/End: Complemental strand, 30352667 - 30352591
Alignment:
215 gtaaggctgcgtacaatacactaaata--gtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccg 289  Q
    |||| |||||||||||||||| ||| |  ||| ||||||||||| || | |||||||||||||||||||||||||||    
30352667 gtaaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccg 30352591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 239
Target Start/End: Complemental strand, 487248 - 487196
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaa 239  Q
    ||||||| |||||||| || |||||||||||| ||||||||||||||||||||    
487248 ggaaacaacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaa 487196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 5306776 - 5306664
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatg----cgggagctttag 282  Q
    |||||||||||||||| |||||  || ||||||| |||||||||||||| |||| ||| ||||||||| | || | ||||||||    |||||||||||     
5306776 ggaaacagcctcttgtgtaaaat-cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtggacgggagctttaa 5306678  T
283 tgcaccggattgcc 296  Q
    |||||||| |||||    
5306677 tgcaccgggttgcc 5306664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 235
Target Start/End: Complemental strand, 39029174 - 39029126
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac 235  Q
    |||||||||||||||| ||||||||| |||||||||| |||||||||||    
39029174 ggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacac 39029126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 288
Target Start/End: Complemental strand, 55830813 - 55830733
Alignment:
208 aaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    ||||| ||||| ||||||||||||||||| ||| |||  ||||| || | || |||||||||||| |||||||||||||||    
55830813 aaacagggtaatgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcacc 55830733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 187 - 286
Target Start/End: Original strand, 37494873 - 37494972
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||||||| ||||||| ||| ||||||| || |||| ||| ||||||||    || | ||||||||| ||||||||||||||    
37494873 ggaaacaacctcttgtgtaaaaaacagggtaaggttgcatacaatataccaaatggtgggacccctttcgggaccctgcgtatgcaggagctttagtgca 37494972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 188 - 286
Target Start/End: Original strand, 20405109 - 20405210
Alignment:
188 gaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||||||||||| ||||||| || ||||||  ||||||||||||||||  ||| ||| ||||||||| | || |  || ||||||||||||||||||    
20405109 gaaacagcctcttgtgtaaaaaaacagggtaagattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 20405208  T
285 ca 286  Q
    ||    
20405209 ca 20405210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 39077907 - 39077800
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || ||||||| ||||||||||| || |||| |||||||  |||  | || | ||| |||||||||||| |||||||    
39077907 ggaaacagcctcttgtgtaaaa--cagggtaaggttgcgtacaatataccaaatggtgagacatctttccggaccctgcatatgcgggagctctagtgca 39077810  T
287 ccggattgcc 296  Q
    |||| |||||    
39077809 ccgggttgcc 39077800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 296
Target Start/End: Complemental strand, 11054241 - 11054152
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||| |||||| ||||||||||||||| |||| | |  |||||||| | || | ||| |||||||||||| ||||||||||| |||||    
11054241 aaaacagggtaagactgcgtacaatacaccaaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 11054152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 296
Target Start/End: Original strand, 20225123 - 20225207
Alignment:
214 ggtaaggctgcgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||| ||  || ||| ||||||||| | || |  || |||||||||||||||||||||||| |||||    
20225123 ggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc 20225207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 287
Target Start/End: Original strand, 21489109 - 21489210
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    |||||||||||||||  |||||||||  ||||| ||||||||||| || | |||| ||| ||||||||| |  | | |||||||||||||||||| ||||    
21489109 ggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgc 21489208  T
286 ac 287  Q
    ||    
21489209 ac 21489210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 280
Target Start/End: Original strand, 25463144 - 25463237
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttt 280  Q
    ||||||| |||||||| ||||||||  || |||| ||||||||| |||| |||| ||| ||||||||| | || | ||| ||||||||||||||    
25463144 ggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt 25463237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 261 - 296
Target Start/End: Original strand, 48033422 - 48033457
Alignment:
261 cttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||||    
48033422 cttgcgtatgcgggagctttagtgcacctgattgcc 48033457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 665 - 715
Target Start/End: Original strand, 17405187 - 17405237
Alignment:
665 attcatacttgtgtttttcttgcataatgtcaaattttatgtttaatagtc 715  Q
    ||||||||||||||| |||||||| ||||||||||   |||||||||||||    
17405187 attcatacttgtgttcttcttgcacaatgtcaaatgaaatgtttaatagtc 17405237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 262 - 296
Target Start/End: Original strand, 19425922 - 19425956
Alignment:
262 ttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||| ||||||||||||    
19425922 ttgcgtatgcgggagctttagtacaccggattgcc 19425956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 248 - 290
Target Start/End: Complemental strand, 34257034 - 34256992
Alignment:
248 ccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||||||||| |||||  |||||||||||||||||||||||    
34257034 ccccttctcagaccttgcacatgcgggagctttagtgcaccgg 34256992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 246 - 296
Target Start/End: Complemental strand, 38755962 - 38755912
Alignment:
246 gaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||| | || | |||||||||||||||||||||||||||| |||||    
38755962 gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 38755912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 246 - 296
Target Start/End: Complemental strand, 40553991 - 40553941
Alignment:
246 gaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||| | || | |||||||||||||||||||||||||||| |||||    
40553991 gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 40553941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 281
Target Start/End: Original strand, 10660426 - 10660521
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagcttta 281  Q
    ||||||| |||||| | ||||||| | |||| |||||| |||||||||| ||  || |||||||||||||  ||| || ||||||||||||||||||    
10660426 ggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaagacct-gcgtatgcgggagcttta 10660521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 281
Target Start/End: Original strand, 10874571 - 10874666
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagcttta 281  Q
    ||||||| |||||| | ||||||| | |||| |||||| |||||||||| ||  || |||||||||||||  ||| || ||||||||||||||||||    
10874571 ggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaagacct-gcgtatgcgggagcttta 10874666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Original strand, 11394950 - 11394983
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
11394950 tgcgtatgcgggagctttagtgcaccgggttgcc 11394983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Original strand, 11404677 - 11404710
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
11404677 tgcgtatgcgggagctttagtgcaccgggttgcc 11404710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 237 - 290
Target Start/End: Original strand, 28494223 - 28494276
Alignment:
237 aaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||| ||| ||||||||| |||||| ||| |||||||||||| |||||||||||    
28494223 aaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgg 28494276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Original strand, 35532090 - 35532123
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
35532090 tgcgtatgcgggagctttagtgcaccgggttgcc 35532123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 62; Significance: 2e-26; HSPs: 47)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 7879660 - 7879769
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||  ||||||| |||||||||||||||||||||||||||||||| |||| ||| ||||||||| | || | ||||||||||||||||| ||||||    
7879660 ggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgca 7879759  T
287 ccggattgcc 296  Q
    |||| |||||    
7879760 ccgggttgcc 7879769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 2541132 - 2541029
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||||| ||||||||||||||| |||||| |||| ||| ||||||||| | |  | ||||||||||||||||||||||||    
2541132 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgca 2541033  T
287 ccgg 290  Q
    ||||    
2541032 ccgg 2541029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 180 - 286
Target Start/End: Complemental strand, 23419794 - 23419688
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctt 279  Q
    |||||| |||||||||||||||| ||||||||| |||||| ||||||||||||||| |||| ||| |||||||||  ||| ||||||| |||||| ||||    
23419794 aagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctagaccttgcgtgtgcgggggctt 23419695  T
280 tagtgca 286  Q
    |||||||    
23419694 tagtgca 23419688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 42798691 - 42798800
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| ||||||| |||||||||||||||||||||||||||||||| |||| ||| ||||| ||| | || | ||| |||||||||||| |||||||    
42798691 ggaaacagtctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgca 42798790  T
287 ccggattgcc 296  Q
     ||| |||||    
42798791 tcgggttgcc 42798800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 38604549 - 38604652
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttt-agtgc 285  Q
    |||||||||||||||| |||||| || |||||||||||||||||||||| |||| ||||||||||||  | || | |||||||||||||||||| |||||    
38604549 ggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagtgc 38604647  T
286 accgg 290  Q
    |||||    
38604648 accgg 38604652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 21172120 - 21172013
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
21172120 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 21172023  T
287 ccggattgcc 296  Q
    |||| |||||    
21172022 ccgggttgcc 21172013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 188 - 290
Target Start/End: Complemental strand, 28362257 - 28362156
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||| ||||||||| ||||||||  |||||||||||||||||||||| |||| ||| ||||||||| |||| ||||| |||| ||||||||| ||||||    
28362257 gaaactgcctcttgtgtaaaaaacttggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccttgcatatgtgggagcttt-gtgcac 28362159  T
288 cgg 290  Q
    |||    
28362158 cgg 28362156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 1408479 - 1408588
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||| |||||||||| |||||||||||||||||||| ||||||||||  |||| ||| ||||||||| | || | ||||||||| | | ||||||| ||    
1408479 ggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatgcagaatctttagttca 1408578  T
287 ccggattgcc 296  Q
    ||||||||||    
1408579 ccggattgcc 1408588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 11617701 - 11617592
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||||||| |||||| ||||||||||||||| |||| ||| |||||||||   || | ||||||||| ||| ||||||||||    
11617701 ggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgca 11617602  T
287 ccggattgcc 296  Q
    |||| |||||    
11617601 ccgggttgcc 11617592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 42805546 - 42805657
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| |||||||||| ||||||||||| |  ||| ||| ||||||||| | || |  || ||||||||||||||||||    
42805546 ggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 42805645  T
285 caccggattgcc 296  Q
    |||||| |||||    
42805646 caccgggttgcc 42805657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 47716481 - 47716592
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || |  || |||||||||||||| |||    
47716481 ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtg 47716580  T
285 caccggattgcc 296  Q
    |||||| |||||    
47716581 caccgggttgcc 47716592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 31591220 - 31591113
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||| | |  |||||||||||||||||||| ||||| ||| ||||||||| | || ||||| |||||||||||| |||||||    
31591220 ggaaacaacctcttgtgtaaaacaga--gtaaggctgcgtacaatacaataaatggtgggaccccttcccggaccttgcatatgcgggagctctagtgca 31591123  T
287 ccggattgcc 296  Q
    |||| |||||    
31591122 ccgggttgcc 31591113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 32758283 - 32758390
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||| ||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
32758283 ggaaacagcctcttgtgtaaaa--cagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 32758380  T
287 ccggattgcc 296  Q
    |||| |||||    
32758381 ccgggttgcc 32758390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 190 - 296
Target Start/End: Complemental strand, 35787378 - 35787273
Alignment:
190 aacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccg 289  Q
    ||||||||||||| |||||| || ||||||| |||||||||||||| |||| | | ||||||||| | || ||||||||||||||||||| | |||||||    
35787378 aacagcctcttgtgtaaaaa-catggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccg 35787280  T
290 gattgcc 296  Q
    | |||||    
35787279 ggttgcc 35787273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 42391211 - 42391104
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||| |||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
42391211 ggaaacagcttcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 42391114  T
287 ccggattgcc 296  Q
    |||| |||||    
42391113 ccgggttgcc 42391104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 48735233 - 48735126
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||| ||  |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
48735233 ggaaacaacctcttgtgtaaaacac--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 48735136  T
287 ccggattgcc 296  Q
    |||| |||||    
48735135 ccgggttgcc 48735126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 19427002 - 19426894
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||| | |||||| ||||||||||||||| |||| ||| || |||||||| || | ||| |||||| |||||| ||||||    
19427002 ggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacaccaaatggtggga-cccttctcggaccctgcatatgcgagagcttcagtgca 19426904  T
287 ccggattgcc 296  Q
    |||| |||||    
19426903 ccgggttgcc 19426894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 27629656 - 27629765
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||||||| ||||||| |||||| ||||||| |||| ||| ||||||||| | |  | ||| ||||||| ||||| ||||||    
27629656 ggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaaatacaccaaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgca 27629755  T
287 ccggattgcc 296  Q
    |||| |||||    
27629756 ccgggttgcc 27629765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 187 - 288
Target Start/End: Complemental strand, 33872022 - 33871922
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| |||||| || | |||||||||||||||||||| |||| ||| ||||||||| |||| | || ||||||| |||||||||||||    
33872022 ggaaacaacctcttgtgtaaaaa-caggataaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgagagctttagtgca 33871924  T
287 cc 288  Q
    ||    
33871923 cc 33871922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 188 - 289
Target Start/End: Original strand, 40463900 - 40464000
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||||| ||||||| |||||| |  |||||||||||||| ||||||| |||| ||| ||||||||||| || | ||||||||||||||||| |||||||    
40463900 gaaacagtctcttgtgtaaaaa-ctgggtaaggctgcgtataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcac 40463998  T
288 cg 289  Q
    ||    
40463999 cg 40464000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 448 - 554
Target Start/End: Complemental strand, 9416284 - 9416179
Alignment:
448 atcaccatctttcaaatagtttcaaaatcttattctaaacttgtgtagcttcgaagtttgaatccttccactattgcaagcaatttgtgcggctttgtag 547  Q
    |||||||||||||||||| |||| || |||||||| ||||||| |||||||  || |||||||| ||||  | ||||||||| ||| |||||||||||||    
9416284 atcaccatctttcaaataatttccaagtcttattccaaacttg-gtagctttaaattttgaatctttcccatgttgcaagcattttctgcggctttgtag 9416186  T
548 tgtgctg 554  Q
    | |||||    
9416185 tatgctg 9416179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 10693184 - 10693077
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||| |   |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
10693184 ggaaacagcctcttgtgtaaaagag--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 10693087  T
287 ccggattgcc 296  Q
    | || |||||    
10693086 ctgggttgcc 10693077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 34626320 - 34626212
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||| ||| |||||| || ||||||||||||| |||||||| |||| ||| || |||||| | || | ||||||||||||||||||||| ||    
34626320 ggaaacagcctcctgtgtaaaaa-cagggtaaggctgcgttcaatacaccaaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttca 34626222  T
287 ccggattgcc 296  Q
     ||| |||||    
34626221 tcgggttgcc 34626212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 38262309 - 38262200
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| ||||||| ||||||| | ||||| | ||| |||||||||| ||||  || ||||||||| |  |   ||||||||||||||||||||||||    
38262309 ggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcccgaacactgcgtatgcgggagctttagtgca 38262210  T
287 ccggattgcc 296  Q
    ||||||||||    
38262209 ccggattgcc 38262200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 180 - 288
Target Start/End: Original strand, 42476888 - 42476994
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctt 279  Q
    |||||| |||||||| ||||||| |||||  ||||||||||||||||||||||||| |||| ||| |||||||||  ||    ||| ||||||||||||     
42476888 aagttctggaaacagtctcttgtgtaaaa--caaggtaaggctgcgtacaatacaccaaatggtgggaccccttcctaggctctgcatatgcgggagctc 42476985  T
280 tagtgcacc 288  Q
    |||||||||    
42476986 tagtgcacc 42476994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 43557494 - 43557606
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagc-tttagt 283  Q
    |||||||||||||||| |||||||||  ||||||||||||||||||||| |  ||| ||| |||||| || | ||   ||||||||||||||| ||||||    
43557494 ggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagt 43557593  T
284 gcaccggattgcc 296  Q
    ||||||| |||||    
43557594 gcaccgggttgcc 43557606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 195 - 286
Target Start/End: Complemental strand, 8149051 - 8148960
Alignment:
195 cctcttgt-ttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||| |||||||| | ||||||| |||||||||||||| |||| ||| ||||||||| |||| |||||||||||| ||| |||||||||    
8149051 cctcttgtgttaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccaga-cttgcgtatgcgagagttttagtgca 8148960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 187 - 293
Target Start/End: Complemental strand, 2663046 - 2662943
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||| |   |||||||||||||||||||||| |||| ||| || ||||| ||||| | ||| |||||||||||| ||| |||    
2663046 ggaaacagcctcttgtgtaaaatag--ggtaaggctgcgtacaatacaccaaatggtggga-cccttttcagaccctgcatatgcgggagctctagcgca 2662950  T
287 ccggatt 293  Q
    |||||||    
2662949 ccggatt 2662943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 204 - 279
Target Start/End: Original strand, 19266489 - 19266564
Alignment:
204 taaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctt 279  Q
    ||||||||| |||||||||||||||||||||| |||| ||| || |||||| | || | |||||||||||||||||    
19266489 taaaaaacagggtaaggctgcgtacaatacaccaaattgtgggatcccttcccggaccctgcgtatgcgggagctt 19266564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 217 - 296
Target Start/End: Complemental strand, 27889399 - 27889320
Alignment:
217 aaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||| || |||||| |||||    
27889399 aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcc 27889320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 214 - 296
Target Start/End: Complemental strand, 18512539 - 18512457
Alignment:
214 ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||||||||||||||||  ||| ||| ||||||||| | || | |||||||||||||||||| |||||| || |||||    
18512539 ggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgcc 18512457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 289
Target Start/End: Original strand, 23231579 - 23231681
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||| |||||||||| ||||| | |||||||||||||||| |||||||  |||  || ||||||||| |  | | ||||||||||| ||||||||||||    
23231579 ggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgca 23231678  T
287 ccg 289  Q
    |||    
23231679 ccg 23231681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 204 - 290
Target Start/End: Complemental strand, 35334912 - 35334826
Alignment:
204 taaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    ||||||||| |||||| ||| |||||||||||  ||| ||| ||||||||| | || | ||||||||| ||||||||||||||||||    
35334912 taaaaaacagggtaagactgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgg 35334826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 187 - 235
Target Start/End: Original strand, 46354216 - 46354264
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac 235  Q
    ||||||| |||||||| ||||||||| ||||||||||||||||||||||    
46354216 ggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacac 46354264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 188 - 235
Target Start/End: Original strand, 16341301 - 16341348
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac 235  Q
    ||||||||||||||| ||||||||| ||||||||| ||||||||||||    
16341301 gaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacac 16341348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 214 - 296
Target Start/End: Original strand, 11741842 - 11741924
Alignment:
214 ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||| |||| ||| || |||||| | |||  |||  ||||||||||| ||||||||||| |||||    
11741842 ggtaaggctgcgtacaatacaccaaatggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgcc 11741924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 614 - 668
Target Start/End: Complemental strand, 22763493 - 22763439
Alignment:
614 aaattgatattgaatctcaaaagggtgctctacataaaaaatttggcaaagattc 668  Q
    ||||||||||||||||||||||||||||||| |||| |   ||||||||||||||    
22763493 aaattgatattgaatctcaaaagggtgctctccatatattttttggcaaagattc 22763439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 222 - 296
Target Start/End: Complemental strand, 47077933 - 47077859
Alignment:
222 tgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||| |||| ||| ||||||||| || | | | | |||||||||||| |||||||||||||||||    
47077933 tgcgtacaatacacaaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgcc 47077859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 21566457 - 21566561
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaa-tagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    |||||| ||||||||| |||||||||  | ||| ||||||||||||||| ||| | ||  ||||||||| |  | | ||| |||||||||||||||||||    
21566457 ggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcatatgcgggagctttagtgc 21566556  T
286 accgg 290  Q
    |||||    
21566557 accgg 21566561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 660 - 715
Target Start/End: Original strand, 4634017 - 4634072
Alignment:
660 caaagattcatacttgtgtttttcttgcataatgtcaaattttatgtttaatagtc 715  Q
    |||||||||||| |||| ||||||||||||||||||| ||   |||||||||||||    
4634017 caaagattcatatttgtatttttcttgcataatgtcatatgaaatgtttaatagtc 4634072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 254
Target Start/End: Complemental strand, 14099119 - 14099052
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttc 254  Q
    ||||| ||||| |||| ||||||||| | |||| ||||||||||||||| |||| ||| |||||||||    
14099119 ggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttc 14099052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 254
Target Start/End: Complemental strand, 14409136 - 14409069
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttc 254  Q
    ||||| ||||| |||| ||||||||| | |||| ||||||||||||||| |||| ||| |||||||||    
14409136 ggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttc 14409069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 225 - 296
Target Start/End: Complemental strand, 23619052 - 23618981
Alignment:
225 gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||||  |||| ||| ||||||||| |||| ||||||| ||| |||||||||||||| ||| |||||    
23619052 gtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgcc 23618981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 205 - 295
Target Start/End: Original strand, 25198766 - 25198856
Alignment:
205 aaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgc 295  Q
    ||||||||||||||| | ||||| ||| |||||||| ||  || |||||| |||| | | |||||| | ||||||||||||||||| ||||    
25198766 aaaaaacaaggtaagaccgcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgc 25198856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 187 - 253
Target Start/End: Complemental strand, 48123597 - 48123531
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagacccctt 253  Q
    |||||||||||||||| |||| |||| |||||  |||| |||||||||| |||| ||| ||||||||    
48123597 ggaaacagcctcttgtgtaaataacagggtaaaactgcatacaatacaccaaatggtgggacccctt 48123531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 275
Target Start/End: Original strand, 7644978 - 7645066
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcggga 275  Q
    |||||||||||||||| ||||||||| ||||||   |||||||||||| | |||| ||| ||||||||| | || | |||||||||||||    
7644978 ggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaaaattgtgggaccccttc-ctgaccctgcgtatgcggga 7645066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 263 - 296
Target Start/End: Original strand, 36602545 - 36602578
Alignment:
263 tgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||||||||| |||||    
36602545 tgcgtatgcgggagctttagtgcaccgggttgcc 36602578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 61; Significance: 8e-26; HSPs: 33)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 8e-26
Query Start/End: Original strand, 190 - 290
Target Start/End: Complemental strand, 16880757 - 16880657
Alignment:
190 aacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccg 289  Q
    ||||||||||||| ||||||||| |||||||||||||||||||||| |||| ||| |||| |||| | || | |||||||||||||||||||||||||||    
16880757 aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg 16880658  T
290 g 290  Q
    |    
16880657 g 16880657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 8e-26
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 38879603 - 38879714
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || | ||||||||||||||||||||||    
38879603 ggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 38879702  T
285 caccggattgcc 296  Q
    |||||| |||||    
38879703 caccgggttgcc 38879714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 24448912 - 24449021
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||||| |||| ||||||| | |||||||||||||||||||||| |||| ||| ||||||||| | || | ||||||||| ||||||||||||||    
24448912 ggaaacagccttttgtgtaaaaaatagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgca 24449011  T
287 ccggattgcc 296  Q
    |||| |||||    
24449012 ccgggttgcc 24449021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 189 - 288
Target Start/End: Complemental strand, 7097870 - 7097772
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    |||||||||||||| |||||| || ||||||| |||||||||||||| |||| ||||||||||||| |  | | ||||||||||||||||||||||||||    
7097870 aaacagcctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 7097772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 32703446 - 32703553
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
32703446 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 32703543  T
287 ccggattgcc 296  Q
    |||| |||||    
32703544 ccgggttgcc 32703553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 41014341 - 41014449
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||| || |||||||||||||||||||||| |||| ||| |||||||||   || |  || ||||||||||||||||||||    
41014341 ggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgcatatgcgggagctttagtgca 41014439  T
287 ccggattgcc 296  Q
    |||| |||||    
41014440 ccgggttgcc 41014449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 20135626 - 20135737
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| |  ||| ||| ||||||||| | || |  || ||||| ||||||| ||||    
20135626 ggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtg 20135725  T
285 caccggattgcc 296  Q
    |||||| |||||    
20135726 caccgggttgcc 20135737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 27328774 - 27328885
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||| ||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| |  | | ||||||||||||||||||| ||    
27328774 ggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatg 27328873  T
285 caccggattgcc 296  Q
    || |||||||||    
27328874 catcggattgcc 27328885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 29334417 - 29334521
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta-aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgc 285  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| | ||| ||| ||||| ||| | || | |||||||| |||| ||||| |||    
29334417 ggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatgc 29334516  T
286 accgg 290  Q
    |||||    
29334517 accgg 29334521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 43574628 - 43574731
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||  ||||||| || |||||| ||||||||||||||||||| || |||| ||| ||||||||| | || | |||||||||||||||||||| |||    
43574628 ggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagagca 43574727  T
287 ccgg 290  Q
    ||||    
43574728 ccgg 43574731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 4619219 - 4619108
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||| |||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || |  || |||||| |||||||||||    
4619219 ggaaatagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtg 4619120  T
285 caccggattgcc 296  Q
    |||||| |||||    
4619119 caccgggttgcc 4619108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 13801882 - 13801771
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacacta--aatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||| ||||||||||| ||||||||| |||||||||||||||||||||| |  ||| ||| ||||||||| | || |  || |||||| |||||||||||    
13801882 ggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtg 13801783  T
285 caccggattgcc 296  Q
    |||||| |||||    
13801782 caccgggttgcc 13801771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 187 - 287
Target Start/End: Complemental strand, 19143055 - 19142956
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| |||||| || |||||||||||||||| ||||| |||| ||| ||||||||| | || | |||||||||||||| |||||||||    
19143055 ggaaacaacctcttgtgtaaaaa-cagggtaaggctgcgtacagtacaccaaatggtgggaccccttcccggaccatgcgtatgcgggagatttagtgca 19142957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 7368420 - 7368527
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| || | ||| ||||||||| | || | ||| |||| ||||||| |||||||    
7368420 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctctagtgca 7368517  T
287 ccggattgcc 296  Q
    |||| |||||    
7368518 ccgggttgcc 7368527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 8170095 - 8169988
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||||| |||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||| || ||||||    
8170095 ggaaacagccttttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgca 8169998  T
287 ccggattgcc 296  Q
    |||| |||||    
8169997 ccgggttgcc 8169988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 35710335 - 35710442
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||| |   ||||||||||||| |||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
35710335 ggaaacagcctcttgtgtaaaatag--ggtaaggctgcgttcaatacaccaaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgca 35710432  T
287 ccggattgcc 296  Q
    |||| |||||    
35710433 ccgggttgcc 35710442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 188 - 277
Target Start/End: Original strand, 2838802 - 2838890
Alignment:
188 gaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagc 277  Q
    |||||||| |||||| |||||| || |||||||||||||||||||||| |||| ||| || |||||||| || | |||||||||||||||    
2838802 gaaacagcatcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatgcgggagc 2838890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 43334224 - 43334335
Alignment:
187 ggaaacagcctcttgtttaaaaaa-caaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagt 283  Q
    |||||||||||| ||| ||||||| || ||||||||||||||||||||||   |||| ||| ||||||||| | || | |||| ||||||||||||||||    
43334224 ggaaacagcctcctgtgtaaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcg-atgcgggagctttagt 43334322  T
284 gcaccggattgcc 296  Q
    ||||||| |||||    
43334323 gcaccgggttgcc 43334335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 225 - 296
Target Start/End: Original strand, 16957374 - 16957445
Alignment:
225 gtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    ||||||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||||| |||||    
16957374 gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 16957445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 214 - 296
Target Start/End: Complemental strand, 34154900 - 34154818
Alignment:
214 ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| ||||||| |||| ||||||||||| |||||    
34154900 ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcc 34154818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 187 - 289
Target Start/End: Complemental strand, 12006443 - 12006339
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaa--atagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||| |||||| | ||||||| | ||||||||| | |||||||||| ||  || ||| ||||||||| |||| | ||| ||||||||||||||||||    
12006443 ggaaacaacctcttatgtaaaaaatagggtaaggctccatacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtg 12006344  T
285 caccg 289  Q
    |||||    
12006343 caccg 12006339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 199 - 280
Target Start/End: Original strand, 22600488 - 22600569
Alignment:
199 ttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttt 280  Q
    |||| ||||| ||| |||||||||| ||||||||||| |||| ||| || |||||| | |||| ||||||||||||||||||    
22600488 ttgtgtaaaacacagggtaaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgcgtatgcgggagcttt 22600569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 280
Target Start/End: Complemental strand, 24323825 - 24323725
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctt 279  Q
    |||||| ||||||| |||||||| ||||| ||| ||||||  |||||| ||||| | |||||||| ||||||||| |||| | ||  |||||||||||||    
24323825 aagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcgggagctt 24323726  T
280 t 280  Q
    |    
24323725 t 24323725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 280
Target Start/End: Complemental strand, 24360449 - 24360349
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctt 279  Q
    |||||| ||||||| |||||||| ||||| ||| ||||||  |||||| ||||| | |||||||| ||||||||| |||| | ||  |||||||||||||    
24360449 aagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcgggagctt 24360350  T
280 t 280  Q
    |    
24360349 t 24360349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 246 - 301
Target Start/End: Original strand, 25622541 - 25622596
Alignment:
246 gaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccatttg 301  Q
    ||||||||| | || | |||||||||||||||||||||||||||||||||| ||||    
25622541 gaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctttg 25622596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 207 - 293
Target Start/End: Complemental strand, 9794471 - 9794385
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggatt 293  Q
    |||||| |||||| |||| |||||||||| |||||||| || |||||| |||| |  || ||||| | |||||||||||||||||||    
9794471 aaaacagggtaagactgcatacaatacaccaaatagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccggatt 9794385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 286
Target Start/End: Original strand, 22187307 - 22187408
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| | |||| |||||||||||||||   ||| | |||||||||||| || | | | | ||||| ||||||||||||    
22187307 ggaaacagcctcttgtgtaaaaaacatgataagactgcgtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtg 22187406  T
285 ca 286  Q
    ||    
22187407 ca 22187408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 284
Target Start/End: Complemental strand, 28516547 - 28516449
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaataca-ctaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    ||||||| |||||||| ||||||||| | || |||||||||||||||| | |||| ||| ||||| ||| |||| | |||| |||| ||||||||||||    
28516547 ggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaatggtgggacccattcccagaccctgcgcatgcaggagctttagtg 28516449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 246 - 300
Target Start/End: Original strand, 39801597 - 39801651
Alignment:
246 gaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgccattt 300  Q
    ||||||||| |||| | | |||||||||||||||||||||||||| |||||||||    
39801597 gaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccattt 39801651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 259
Target Start/End: Original strand, 41425963 - 41426042
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcaga 259  Q
    |||||| ||||||| | | |||| ||||||||| ||||||||||| |||||||||| || | ||| ||||||||| ||||    
41425963 aagttctggaaacaacttattgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccaga 41426042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 250 - 296
Target Start/End: Complemental strand, 29184111 - 29184065
Alignment:
250 ccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||| ||||| | |||||||||||||||||||||||||||| |||||    
29184111 ccttgtcagaccatgcgtatgcgggagctttagtgcaccgggttgcc 29184065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 290
Target Start/End: Original strand, 3771379 - 3771464
Alignment:
205 aaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccgg 290  Q
    |||||||| |||||||||| | ||||||||| || | ||| ||||||||| | ||   || ||||| |||||||||||||||||||    
3771379 aaaaaacagggtaaggctgtgaacaatacaccaattggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgg 3771464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 216 - 288
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
216 taaggctgcgtacaatacactaaa-tagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    |||||||||||||||||||| ||| | ||| ||||||||| | |||  |||||||||  |||||||||||||||    
12477205 taaggctgcgtacaatacaccaaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc 12477132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258 (Bit Score: 58; Significance: 5e-24; HSPs: 1)
Name: scaffold0258
Description:

Target: scaffold0258; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 13136 - 13028
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||  |||||| |||||||||||||||||||||||||  ||| ||| ||||||||| |||| | |||||||||||| |||||||||||    
13136 ggaaacagcctcttgcgtaaaaa-caaggtaaggctgcgtacaatacaccgaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgca 13038  T
287 ccggattgcc 296  Q
    |||| |||||    
13037 ccgggttgcc 13028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 58; Significance: 5e-24; HSPs: 3)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 46853 - 46962
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||| |||||||| ||||||| | ||||||| |||||||||||||| |||| ||| ||||||||| | || | ||||||||||||||||||||||||    
46853 ggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 46952  T
287 ccggattgcc 296  Q
    |||| |||||    
46953 ccgggttgcc 46962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #2
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 190 - 286
Target Start/End: Complemental strand, 24882 - 24786
Alignment:
190 aacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||||||||||| ||||||||| ||||||||||||||||| |||| |||| ||| ||||||||| |  | | ||||||||||||||||||||||||    
24882 aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca 24786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #3
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 180 - 287
Target Start/End: Original strand, 43674 - 43780
Alignment:
180 aagttccggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagacccc-ttctcagatcttgcgtatgcgggagct 278  Q
    |||||| ||||||||| |||||| |||||  ||||||||||||||||||||||||| |||| ||| |||||| ||||| || | ||| ||||||||||||    
43674 aagttctggaaacagcgtcttgtgtaaaa--caaggtaaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagct 43771  T
279 ttagtgcac 287  Q
     ||||||||    
43772 ctagtgcac 43780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 53; Significance: 5e-21; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 58999 - 59110
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacac--taaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtg 284  Q
    |||||||||||||||| ||||||||| |||||| |||||||||||||||   |||| ||| ||||||||| ||||   ||||||||||||||||||||||    
58999 ggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtg 59098  T
285 caccggattgcc 296  Q
    || ||| |||||    
59099 catcgggttgcc 59110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0311 (Bit Score: 51; Significance: 8e-20; HSPs: 1)
Name: scaffold0311
Description:

Target: scaffold0311; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 189 - 287
Target Start/End: Original strand, 10834 - 10932
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcac 287  Q
    ||||| |||||||| ||||||||| |||| |||||||| |||||||| |||| ||| ||||||||| | || | |||||||||||||||||||||||||    
10834 aaacaacctcttgtgtaaaaaacagggtagggctgcgtccaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac 10932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 51; Significance: 8e-20; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 48745 - 48638
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
48745 ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 48648  T
287 ccggattgcc 296  Q
    |||| |||||    
48647 ccgggttgcc 48638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 47; Significance: 2e-17; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 214 - 296
Target Start/End: Complemental strand, 24219 - 24137
Alignment:
214 ggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgcc 296  Q
    |||||||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||||||||||||    
24219 ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcc 24137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 47; Significance: 2e-17; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 187 - 296
Target Start/End: Original strand, 30601 - 30708
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  || |||| ||||||||||||||||| |||| ||| ||||||||| | || | ||| |||||||||||| |||||||    
30601 ggaaacagcctcttgtgtaaaa--cagggtagggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 30698  T
287 ccggattgcc 296  Q
    |||| |||||    
30699 ccgggttgcc 30708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 46; Significance: 7e-17; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 196 - 301
Target Start/End: Complemental strand, 72971 - 72866
Alignment:
196 ctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcaccggattgc 295  Q
    ||||||| ||||||||| ||||||||||| |||||||||| |||| ||   |||||||| | || | |||||||||||||||||||||||||| | ||||    
72971 ctcttgtgtaaaaaacacggtaaggctgcctacaatacaccaaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgc 72872  T
296 catttg 301  Q
    | ||||    
72871 cctttg 72866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0954 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0954
Description:

Target: scaffold0954; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 289
Target Start/End: Original strand, 3566 - 3668
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    ||||| |||||||||| ||||| | |||||||||||||||| |||||||  |||  || ||||||||| |  | | ||||||||||| ||||||||||||    
3566 ggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgca 3665  T
287 ccg 289  Q
    |||    
3666 ccg 3668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 288
Target Start/End: Original strand, 11153 - 11252
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| |||||  ||| |||||||||| |||||||||| |||| ||| ||| ||||| | || | ||| |||||||||||| |||||||    
11153 ggaaacagcctcttgtgtaaaa--caaagtaaggctgcttacaatacaccaaatggtgggacaccttcccggaccctgcatatgcgggagctctagtgca 11250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 39; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 10161 - 10054
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||| | |  ||||| ||||||||||||||| |||||||| ||||||||| | || | ||| ||||| ||||||  ||||||    
10161 ggaaacagcctcttgtgtaaaacaga--gtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgca 10064  T
287 ccggattgcc 296  Q
    |||| |||||    
10063 ccgggttgcc 10054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 296
Target Start/End: Complemental strand, 20489 - 20382
Alignment:
187 ggaaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgca 286  Q
    |||||||||||||||| ||||| | |  ||||| ||||||||||||||| |||||||| ||||||||| | || | ||| ||||| ||||||  ||||||    
20489 ggaaacagcctcttgtgtaaaacaga--gtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgca 20392  T
287 ccggattgcc 296  Q
    |||| |||||    
20391 ccgggttgcc 20382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0167 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0167
Description:

Target: scaffold0167; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 189 - 280
Target Start/End: Original strand, 23623 - 23714
Alignment:
189 aaacagcctcttgtttaaaaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagcttt 280  Q
    ||||| |||||||| ||||||||| ||| ||||||||||||||  |  |||| ||| ||||||||| |||| |||| ||||| |||||||||    
23623 aaacaacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagcaaatggtgggaccccttcccagaccttgagtatgtgggagcttt 23714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 288
Target Start/End: Complemental strand, 1680 - 1599
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtatgcgggagctttagtgcacc 288  Q
    |||||| | ||||||||| |||||||||| ||||  || ||||||||| | || |  |||||||||||||||||||||||||    
1680 aaaacaggataaggctgcatacaatacaccaaatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcacc 1599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 207 - 269
Target Start/End: Complemental strand, 35110 - 35048
Alignment:
207 aaaacaaggtaaggctgcgtacaatacactaaatagtgagaccccttctcagatcttgcgtat 269  Q
    |||||| |||||||||||||||||||||| |||| ||| ||||| |||   ||||||||||||    
35110 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccctttcctggatcttgcgtat 35048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University