View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4746-Insertion-14 (Length: 149)
Name: NF4746-Insertion-14
Description: NF4746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4746-Insertion-14 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 9 - 149
Target Start/End: Complemental strand, 536189 - 536049
Alignment:
| Q |
9 |
taaaaacaatgaagttttagactctttgctatatttgctatcattattattcctaattttgcattaatttcatgaaggccgaattttgttttcatgttta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
536189 |
taaaaacaatgaagttttagactctttgctatatttgctaccattattattcctaattttgcattaatttcatgaagggcgaattttgttttcatgttta |
536090 |
T |
 |
| Q |
109 |
gcaaaaaccaccttctaagatagaagttggtacttccaata |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
536089 |
gcaaaaaccaccttctaagatagaagttggtacttccaata |
536049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University