View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4746-Insertion-17 (Length: 94)
Name: NF4746-Insertion-17
Description: NF4746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4746-Insertion-17 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 3e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 833822 - 833736
Alignment:
| Q |
8 |
tcacactgatgacataaaccatgagatagaacttctaaaatctcttctttcgtcaatgaactcagaagttccatgtttggagaatag |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
833822 |
tcacactgatgacataaaccatgagatagaacttctaaaatctcttctttcgtcaatgaactcagaagttccatgtttggagaatag |
833736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 812166 - 812083
Alignment:
| Q |
8 |
tcacactgatgacataaaccatgagatagaacttctaaaatctcttctttcgtcaatgaactcagaagttccatgtttggagaa |
91 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| || |||||| |||||||| |
|
|
| T |
812166 |
tcacagtggtgacataaaccatgagatagaacctctaaaatctcttctttcgtcaatgaattcaaaatttccattgttggagaa |
812083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University