View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4746-Insertion-18 (Length: 101)
Name: NF4746-Insertion-18
Description: NF4746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4746-Insertion-18 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 2e-46; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 40276615 - 40276708
Alignment:
| Q |
8 |
agttttggatcaagagctctaaggtcacgcgtaggtaaccctgttcgttgcatgatggagtgtttgtcaatatcttcaacgcgtgattcacctg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40276615 |
agttttggatcaagagctctaaggtcacgcgtaggtaaccctgttcgttgcatgatggagtgtttgtcaatatcttcaacgcgtgattcacctg |
40276708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 9e-18
Query Start/End: Original strand, 24 - 101
Target Start/End: Original strand, 39625351 - 39625428
Alignment:
| Q |
24 |
ctctaaggtcacgcgtaggtaaccctgttcgttgcatgatggagtgtttgtcaatatcttcaacgcgtgattcacctg |
101 |
Q |
| |
|
||||||||||||| | |||||| ||||||||| ||||||||||||||||||| ||||| || || ||||||||||||| |
|
|
| T |
39625351 |
ctctaaggtcacgtgcaggtaaacctgttcgtcgcatgatggagtgtttgtcgatatcctcgacacgtgattcacctg |
39625428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 9e-18
Query Start/End: Original strand, 24 - 101
Target Start/End: Original strand, 39634901 - 39634978
Alignment:
| Q |
24 |
ctctaaggtcacgcgtaggtaaccctgttcgttgcatgatggagtgtttgtcaatatcttcaacgcgtgattcacctg |
101 |
Q |
| |
|
||||||||||||| | |||||| ||||||||| ||||||||||||||||||| ||||| || || ||||||||||||| |
|
|
| T |
39634901 |
ctctaaggtcacgtgcaggtaaacctgttcgtcgcatgatggagtgtttgtcgatatcctcgacacgtgattcacctg |
39634978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University