View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4746_high_17 (Length: 220)
Name: NF4746_high_17
Description: NF4746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4746_high_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 54015024 - 54014822
Alignment:
| Q |
18 |
attatatggaccaattgtggggaaagtattgtatgaaattttgaatgaagaaccctcatactccaacctcagctggtggtgcattcatttgctcgtacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54015024 |
attatatggaccaattgtggggaaagtattgtatgaaattttgaatgaagaaccctcatactccaacctcagctggtggtgcattcatttgctcgtacta |
54014925 |
T |
 |
| Q |
118 |
tgtggtctaagaactctactacacgtgttttggagttcttatagtaacatgctttttcttactagaaatcgaaggattcttcaacaaggtgttgatttca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014924 |
tgtggtctaagaactctactacacgtgttttggagttcttatagtaacatgctttttcttactagaaatcgaaggattcttcaacaaggtgttgatttca |
54014825 |
T |
 |
| Q |
218 |
agc |
220 |
Q |
| |
|
||| |
|
|
| T |
54014824 |
agc |
54014822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University