View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4746_high_8 (Length: 308)
Name: NF4746_high_8
Description: NF4746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4746_high_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 4586970 - 4587282
Alignment:
| Q |
1 |
cgattcttttttgtattttcctcactgctctcttctttaactagcagcagagcggatggtatgctgttagtttaaatatgctttgctttgttacatatat |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4586970 |
cgattcttttttgtattttcctcaccgctctcttctttaactagcagcagaggggatggtatgctgttagtttaaatatgctttgctttgttacatatat |
4587069 |
T |
 |
| Q |
101 |
at----tgcggttagtttctttataagatggccatatagtttaaagttcagtccttgttatctccattcttttatacaatatataaatttcaaagcaagt |
196 |
Q |
| |
|
|| || |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4587070 |
atatattgtggttagtttctttataagatggccatatagtttacagttcagtccttgttatctccattcttttatataatatataaatttcaaagcaagt |
4587169 |
T |
 |
| Q |
197 |
aaggtaggcctcgaagctatccatactttattccaaagggaactttcttgaggagggtgttagatgtaaaaatcattcacttgctttcaccaataaactt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4587170 |
aaggtaggcctcgaagctatccatactttattccaaagggaactttcttgaggggggtgttagatgtaaaaatcattcacttgctttcaccaataaactt |
4587269 |
T |
 |
| Q |
297 |
-aaatctttgtgc |
308 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4587270 |
aaaatctttgtgc |
4587282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University