View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4746_low_12 (Length: 252)
Name: NF4746_low_12
Description: NF4746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4746_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 42250124 - 42250361
Alignment:
| Q |
1 |
acgcaaaggtgaaggaaaatgcgaaggaatatgcagatagggacgatgaagctgaacaagaatgaagatggatttggatgataatgatgatgatgttata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42250124 |
acgcaaaggtgaaggaaaatgcgaaggaatatgcagatagggacgatgaagctgaacaagaatgaagatggatttggatgataatgatgatgatgttata |
42250223 |
T |
|
| Q |
101 |
tatgaagcttttctcgtctatgtgtttttgaccaattagaattatacacgtggtggatccatctttcttttatgaatatcctttttccaataccaataaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42250224 |
tatgaagtttttctcgtctatgtgtttttgaccaattagaattatacacgtggtggatccatctttcttttatgaatatcctttttccaataccaataaa |
42250323 |
T |
|
| Q |
201 |
ttagttggg-aataccgtgaatctatgtcactcaatgt |
237 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42250324 |
ttagttgggaaataccgtgaatctatgtcactcaatgt |
42250361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University