View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4748-Insertion-14 (Length: 179)
Name: NF4748-Insertion-14
Description: NF4748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4748-Insertion-14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 7e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 7e-54
Query Start/End: Original strand, 65 - 179
Target Start/End: Complemental strand, 52062608 - 52062494
Alignment:
| Q |
65 |
aatgcatttcaacataaatttacatcatatgattattatttttgattaaacattcatccgacaaccgtttcaaaataaattcgaagtagcactaacattt |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52062608 |
aatgcatttcaacataaatttacatcatatgattattattttttattaaacattcatccgacaaccgtttcaaaataaattcaaagtagcactaacattt |
52062509 |
T |
|
| Q |
165 |
caaattaaaggtgtg |
179 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52062508 |
caaattaaaggtgtg |
52062494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University