View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4748_low_3 (Length: 251)
Name: NF4748_low_3
Description: NF4748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4748_low_3 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 26 - 251
Target Start/End: Original strand, 40687438 - 40687663
Alignment:
| Q |
26 |
agagagtgaggggatttgaagaaagcttcatgtttctccacatctctttattttgagtaaactatgttggtaaaaatgtaatcattgttggcctttcctt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40687438 |
agagagtgaggggatttgaagaaagcttcatgtttctccacatctctttattttgagtaaactatgttggtaaaaatgtaatcattgttggcctttcctt |
40687537 |
T |
|
| Q |
126 |
tgtcttttgaactactactcttgacatgattatgatcacattaaactttattctcatgatcctttttgttattttggtacttcactccaacatatagtgt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40687538 |
tgtcttttgaactactactcttgacatgattatgatcacattaaacttcattctcatgatcctttttgttattttggtacttcactccaacatatagagt |
40687637 |
T |
|
| Q |
226 |
ggttgttttctcactctaacaaaacc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40687638 |
ggttgttttctcactctaacaaaacc |
40687663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 179
Target Start/End: Complemental strand, 34407751 - 34407695
Alignment:
| Q |
125 |
ttgtcttttgaactactactcttgacatgattatgat--cacattaaactttattct |
179 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| | |||||||||||| ||||| |
|
|
| T |
34407751 |
ttgtcttttgaactattgctcttgacatgattatgttcacacattaaacttcattct |
34407695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University