View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4749-Insertion-8 (Length: 223)
Name: NF4749-Insertion-8
Description: NF4749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4749-Insertion-8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 42297715 - 42297511
Alignment:
| Q |
19 |
caaataacgatcattagtttcctactcgaccnnnnnnngacaatttttagcttctacctttatacgaatgatacaatgggtaaaaaagagaggataaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42297715 |
caaataacgatcattagtttcctactcgaccaaaaaaagacaatttttagcttctacctttatacgaatgatacaatgggtaaaaaagagaggataaaaa |
42297616 |
T |
 |
| Q |
119 |
catatcaaggtcatggtatcagtcattgaaagcatttatccaaccacgtcgtaattnnnnnnntgtatttgcttaactatgcaatcattataaaaaactt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42297615 |
catatcaaggtcatggtatcagtcattgaaagcatttatccaaccacgtcgtaattaaaaaaatgtatttgcttaactatgcaatcattataaaaaactt |
42297516 |
T |
 |
| Q |
219 |
accaa |
223 |
Q |
| |
|
||||| |
|
|
| T |
42297515 |
accaa |
42297511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University