View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4750-Insertion-14 (Length: 379)
Name: NF4750-Insertion-14
Description: NF4750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4750-Insertion-14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 6 - 191
Target Start/End: Complemental strand, 44407410 - 44407221
Alignment:
| Q |
6 |
caataaatactaacatcaatgaattaagt----tgattgaaatcaaaacaccattacattgcatatagtgttgggaattaagaacttaccatctgtataa |
101 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407410 |
caataaatactaacatcaatgaattaattaaggtgattgaaatcaaaacaccattacattgcatatagtgttgggaattaagaacttaccatctgtataa |
44407311 |
T |
 |
| Q |
102 |
gacaaagcaccttggcatactgagaggaatagaaccaatagaactttaaacttctgcatattttaattttttgtttgtatgaatctcaaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407310 |
gacaaagcaccttggcatactgagaggaatagaaccaatagaactttaaacttctgcatattttaattttttgtttgtatgaatctcaaa |
44407221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 247 - 379
Target Start/End: Complemental strand, 44407160 - 44407028
Alignment:
| Q |
247 |
cacagggttttatttgaatcataaaatgaaaatgccactaaattcagcaaaaaataacatcaatgccactggaactatcctatcctaaattttccagcaa |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407160 |
cacagggttttatttgaatcataaaatgaaaatgccactaaattcagcaaaaaataacatcaatgccactggaactatcctatcctaaattttccagcaa |
44407061 |
T |
 |
| Q |
347 |
gagatggctttgccctgaatacatacatgttag |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44407060 |
gagatggctttgccctgaatacatacatgttag |
44407028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University