View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4750-Insertion-19 (Length: 250)
Name: NF4750-Insertion-19
Description: NF4750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4750-Insertion-19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 5 - 250
Target Start/End: Original strand, 48636696 - 48636941
Alignment:
| Q |
5 |
ttattattgataatgataactatgctgttaaattgtgcattaattttatgttttgtcgaactttagtgttcaagcttgatagnnnnnnnnnnggctgtaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48636696 |
ttattattgataatgataactatgctgttaaattgtgcattaattttatgttttgtcgaactttagtgttcaagcttgatagttttttttttggctgtaa |
48636795 |
T |
|
| Q |
105 |
tgagtctagcgatgaaactcacacacacagtgatgagaagtggggaattgcggatacaaacctgcaccctaacatatgagatgtccctgtagccttttac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48636796 |
tgagtctagcgatgaaactcacacacacagtgatgagaagtggggaattgcggatacaaacctgcaccctaacatatgagatgtccctgtagccttttac |
48636895 |
T |
|
| Q |
205 |
tgtatgagatgagacaaacttgataggtttttaattaagaaagaaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48636896 |
tgtatgagatgagacaaacttgataggtttttaattaagaaagaaa |
48636941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University