View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4750-Insertion-9 (Length: 188)
Name: NF4750-Insertion-9
Description: NF4750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4750-Insertion-9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 78 - 184
Target Start/End: Original strand, 5644801 - 5644908
Alignment:
| Q |
78 |
agatagtgaagagcagcagtgaaacgagtgaagaaaat-gcgattgtagaaagctgttttgaattgaagttttgcaacaagagcgggagaattaattgaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5644801 |
agatagtgaagagcagcagtgaaacgagtgaagaaaaaagcgattgtagaaagctgttttgaattgaagttttgcaacaagagcgggagaattaattgaa |
5644900 |
T |
|
| Q |
177 |
tattccac |
184 |
Q |
| |
|
|||||||| |
|
|
| T |
5644901 |
tattccac |
5644908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 7 - 79
Target Start/End: Original strand, 5644683 - 5644755
Alignment:
| Q |
7 |
agaacgattaacggcgtcgttttgttgttgttccgatggttgacgaacacgtttacgcggcattgttgctgag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5644683 |
agaacgattaacggcgtcgttttgttgttgttccgatggttgacgaacacgtttacgcggcattgttgctgag |
5644755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University