View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4750_high_13 (Length: 222)
Name: NF4750_high_13
Description: NF4750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4750_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 37111910 - 37112115
Alignment:
| Q |
1 |
gctactgcggcgttgcctatgatatactcaaggagaatgtttccggcagctataaaggcaacaaaatctcccaattctactcttaagtaagcaaatgacc |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111910 |
gctaccgcggcgttgcctatgatatactcaaagaggatgtttccggcagctataaaggcaacaaaatctcccaattctactcttaagtaagcaaatgacc |
37112009 |
T |
|
| Q |
101 |
cacctgaagtataagaagaaaatttgtataaacacaaaccagtatcaaattcaaactattaataatccctccctcaatctcaccgttctcttttagttgt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
37112010 |
cacctgaagtataagaggaaaatttgtataaacacaaaccagtatcaaattcaaactattaataatccctccctcaatctcacccttcttttttagttgt |
37112109 |
T |
|
| Q |
201 |
catttt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
37112110 |
catttt |
37112115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 37120165 - 37120272
Alignment:
| Q |
1 |
gctactgcggcgttgcctatgatatactcaaggagaatgtttccggcagctataaaggcaacaaaatctcccaattctactcttaagtaagcaaatgacc |
100 |
Q |
| |
|
||||| || |||||||| |||| ||| |||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
37120165 |
gctaccgccgcgttgccaatgacatattcaaggaggatgtttccggcagctatgaaggcaacaaaatctcccatttctactctcaagtaagcaaatgacc |
37120264 |
T |
|
| Q |
101 |
cacctgaa |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
37120265 |
cacctgaa |
37120272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 28 - 107
Target Start/End: Complemental strand, 37136061 - 37135982
Alignment:
| Q |
28 |
tcaaggagaatgtttccggcagctataaaggcaacaaaatctcccaattctactcttaagtaagcaaatgacccacctga |
107 |
Q |
| |
|
|||||||| |||||||| |||||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37136061 |
tcaaggagtatgtttccagcagctatgaaggccacaaagtctcccaattctactcttaagtatgcaaatgacccacctga |
37135982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University