View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4750_high_15 (Length: 209)
Name: NF4750_high_15
Description: NF4750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4750_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 18 - 113
Target Start/End: Complemental strand, 30888192 - 30888097
Alignment:
| Q |
18 |
gaatgttttactatttttgaacacaaaggtggtagagattagcactatattaggagcataacatggcttgccacgatcgatcagttaaacctccaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30888192 |
gaatgttttactatttttgaacacaaaggtggtagagattagcactatattaggagcataacatggcttgccacgatctatcagttaaacctccaa |
30888097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University