View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4750_high_15 (Length: 209)

Name: NF4750_high_15
Description: NF4750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4750_high_15
NF4750_high_15
[»] chr8 (1 HSPs)
chr8 (18-113)||(30888097-30888192)


Alignment Details
Target: chr8 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 18 - 113
Target Start/End: Complemental strand, 30888192 - 30888097
Alignment:
18 gaatgttttactatttttgaacacaaaggtggtagagattagcactatattaggagcataacatggcttgccacgatcgatcagttaaacctccaa 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
30888192 gaatgttttactatttttgaacacaaaggtggtagagattagcactatattaggagcataacatggcttgccacgatctatcagttaaacctccaa 30888097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University