View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4751-Insertion-4 (Length: 279)
Name: NF4751-Insertion-4
Description: NF4751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4751-Insertion-4 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 6 - 279
Target Start/End: Original strand, 25181913 - 25182186
Alignment:
| Q |
6 |
cacaaacagcttcaaatcccgtccacgttttcctctttcatcttccatttccacggtgccttcctccgacgaagaacccaccacaaaccctataccaaaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25181913 |
cacaaacagcttcaaatcccgtccacgttttcctctttcatcttccatttccacaatgccttcctccgacgaagaacccaccacaaaccctataccaaaa |
25182012 |
T |
|
| Q |
106 |
caccccccacgttcatcatcaacctccacaagattcttcgaagaagtactcaacggaccaaaccaacgttgtttagaaaatttccgaatggacaaagtcg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25182013 |
caccccccacgttcatcatcaacctccacaaaattcttcgaagaagtactcaacggaccaaaccaacgttgtttagaaaatttccgaatggacaaagtcg |
25182112 |
T |
|
| Q |
206 |
tattctataaagtatgtgatattctagaaaccaaggggttattacgtgacacgaataggagtaaaattggagag |
279 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||| |
|
|
| T |
25182113 |
tattctataaactatgtgatattctagaaaccaagggtttattacgtgacacgaataggattaaaattgaagag |
25182186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University