View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4752-Insertion-12 (Length: 360)
Name: NF4752-Insertion-12
Description: NF4752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4752-Insertion-12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 6 - 354
Target Start/End: Complemental strand, 49755718 - 49755361
Alignment:
| Q |
6 |
cagtactctcttctgtctcttgcttttcaatccaacggccaatggaactcttcgttttctttcatctctaccgtgttcctctaacagaactcgccttgtc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
49755718 |
cagtactctcttctgtctcttgcttttcaatccaacggccaatggaactcttcgttttctttcatctctaccgtgttcctctaaaagaactcgcctagtc |
49755619 |
T |
|
| Q |
106 |
ggaagagttaactcggttccaacgaacgacgaagagtcatgatgttgtggaagagtggaccgagaagggagatagtggaagaagaaagtggaaattgcta |
205 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755618 |
ggaagagttaactccgttccaacgaacgaagaagagtcatgatgttgtggaagagtggatcgagaagggagatagtggaagaagaaagtggaaattgcta |
49755519 |
T |
|
| Q |
206 |
ttccaatgagaaggaaagggactcgatttagaagca---------tgtttgttctcgttcttggaagaggattatcacgatgggatgatgaatctgtggt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755518 |
ttccaatgagaaggaaagggactcgatttagaagcatgttgatgatgtttgttctcgttcttggaagaggattatcacgatgggatgatgaatctgtggt |
49755419 |
T |
|
| Q |
297 |
ttgatctcttgtttggtttctgtgaattagttcagagttcattttgtttttgtatttt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49755418 |
ttgatctcttgtttggtttctgtgaattagttcagaactcattttgtttttgtatttt |
49755361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University