View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4752-Insertion-15 (Length: 48)
Name: NF4752-Insertion-15
Description: NF4752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4752-Insertion-15 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.000000000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 27766368 - 27766408
Alignment:
| Q |
8 |
cataggtgctattgccaccacctgtagtcctttatacaccg |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27766368 |
cataggtgctattgccaccacctgtagtcctttatacaccg |
27766408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 47
Target Start/End: Original strand, 27755708 - 27755747
Alignment:
| Q |
8 |
cataggtgctattgccaccacctgtagtcctttatacacc |
47 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27755708 |
cataggtgctattgccaccacctctagtcctttatacacc |
27755747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University