View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4752_low_14 (Length: 368)
Name: NF4752_low_14
Description: NF4752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4752_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 17 - 351
Target Start/End: Original strand, 48019119 - 48019449
Alignment:
| Q |
17 |
atgaatagtagctatccaaagaccaaaaatagagacaattagagcaaacaaagcaatatgaaatgatgattaattaatactaatacacacctcatgtccc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48019119 |
atgaatagtagctatccaaagaccaaaaatagagacaattagagcaaacaaagcaatatgaaatgatgatta----atactaatacacacctcatgtccc |
48019214 |
T |
|
| Q |
117 |
tcgccgttattaacaacttcagggggctcattgcgacggaataaaagtggtgaccgtcgttgtttcttcccatattcatacaaagatttagctctcaaca |
216 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019215 |
tctccgttattaacaacttctgggggctcattgcgaccgaataaaagttgtgaccgtcgttgtttcttcccatattcatacaaagatttagctctcaaca |
48019314 |
T |
|
| Q |
217 |
catcatgcaccgtgctccgccgtatcggtacagttccttttggacaacgtgtcccattttggtgccacatttgccatgccacaccactcttactacttct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019315 |
catcatgcaccgtgctccgccgtatcggtacagttccttttggacaacgtgtcccattttggtgccacatttgccatgccacaccactcttactacttct |
48019414 |
T |
|
| Q |
317 |
ctcatcttctctagactcttcattaatattcatat |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019415 |
ctcatcttctctagactcttcattaatattcatat |
48019449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 178 - 295
Target Start/End: Complemental strand, 35407175 - 35407058
Alignment:
| Q |
178 |
gtttcttcccatattcatacaaagatttagctctcaacacatcatgcaccgtgctccgccgtatcggtacagttccttttggacaacgtgtcccattttg |
277 |
Q |
| |
|
||||||| ||||| |||||||||||||| ||||||||||||||||| || || |||| ||| || || || ||||| |||||||| | |||||||||| | |
|
|
| T |
35407175 |
gtttcttaccataatcatacaaagattttgctctcaacacatcatgtactgtactcctccgcataggaaccgttccctttggacaccttgtcccatttcg |
35407076 |
T |
|
| Q |
278 |
gtgccacatttgccatgc |
295 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35407075 |
atgccacatttgccatgc |
35407058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University