View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4752_low_19 (Length: 319)
Name: NF4752_low_19
Description: NF4752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4752_low_19 |
 | |
|
| [»] scaffold0262 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0262 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 120 - 306
Target Start/End: Original strand, 16032 - 16218
Alignment:
| Q |
120 |
ttggataaaattttataattaagcttatgatgaaagaagaaaaggtacctgtgtaattgatgttacagtagtttattaaaagtaccatttcaccatgtaa |
219 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16032 |
ttggataattttttataattaagcttatgacgaaagaagaaacggtacctgtgtaattgatgttacagtagtttattaaaagtaccatttcaccatgtaa |
16131 |
T |
|
| Q |
220 |
atcaacaatatattttgttaaagtattcatcatctccatataatcagtttctgatgaatgacttccatttgttccccttaaactgat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16132 |
atcaacaatatattttgttaaagtattcatcatctccatataatcagtttctgatgaatgacttccatttgttccccttaaactgat |
16218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University