View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4752_low_22 (Length: 289)
Name: NF4752_low_22
Description: NF4752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4752_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 24 - 265
Target Start/End: Complemental strand, 46768386 - 46768123
Alignment:
| Q |
24 |
cctcaagactaaactcccaattctgaacaccaaagctaagccacctctaactcccatcatcacatcacattt----------------------atgaaa |
101 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
46768386 |
cctcaagactaaactcccaatcctgaacaccaaagctaagccacctctaactcctatcatcacatcacatttgtgtacaattatctctctttttatgaaa |
46768287 |
T |
 |
| Q |
102 |
atgcttttaaaacaataccctgaagtaattattgtggattgcagagcacttagtttaccctcctcagtcctcaccagtaacttctgttggctgtatgcat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46768286 |
atgcttttaaaacaataccctgaagtaattattgtggattgcagagcacttagtttaccctcctcagtcctcaccagtaacttctgttggctgtatgcat |
46768187 |
T |
 |
| Q |
202 |
tgtgacatatttagtaaccagttagtattacacaactaattttttgatattgcatgttatgtat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46768186 |
tgtgacatatttagtaaccagttagtattacacaactaattttttgatattgcatgttatgtat |
46768123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University