View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4753-Insertion-16 (Length: 206)
Name: NF4753-Insertion-16
Description: NF4753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4753-Insertion-16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 206
Target Start/End: Original strand, 48357395 - 48357593
Alignment:
| Q |
8 |
gcttgggttgttactgaatatctaagcaccacacttaaggagtggctttatggtcctggcaaaagacgcagagatagaattgtgccacttcctcctttca |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357395 |
gcttgggtggttactgaatatctaagcaccacacttaaggagtggctttatggtcctggcaaaagacgcagagatagaattgtgccacttcctcctttca |
48357494 |
T |
 |
| Q |
108 |
aagaaagactaacaagggtcatagagatagcccaagctatgcagtatcttcatgagcaaaagcccaaaattattcaccgtgacttgaagcccagcaaca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357495 |
aagaaagactaacaagggtcatagagatagcccaagctatgcagtatcttcatgagcaaaagcccaaaattattcaccgtgacttgaagcccagcaaca |
48357593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University