View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4753-Insertion-7 (Length: 425)
Name: NF4753-Insertion-7
Description: NF4753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4753-Insertion-7 |
 | |
|
| [»] scaffold0209 (2 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 49; Significance: 7e-19; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 353 - 417
Target Start/End: Original strand, 10868664 - 10868728
Alignment:
| Q |
353 |
tggacactttcttactgttaagtttcaattttcaatggtgacattacatggtgccatgaaagagc |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| | ||||||||||||||| ||||||||| |
|
|
| T |
10868664 |
tggacactttcttactgttaagtttcaattttctatgctcacattacatggtgccgtgaaagagc |
10868728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 353 - 425
Target Start/End: Complemental strand, 10885721 - 10885649
Alignment:
| Q |
353 |
tggacactttcttactgttaagtttcaattttcaatggtgacattacatggtgccatgaaagagcagtgatgt |
425 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| | ||||||||||||||||||| |||||| |||| |
|
|
| T |
10885721 |
tggacactttcttactcttaagtttcaattttgtatgctcgaattacatggtgccatgaaaaagcagtaatgt |
10885649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 242 - 313
Target Start/End: Original strand, 10868405 - 10868475
Alignment:
| Q |
242 |
cattggtgaattatgttttgtggtgcactttttgtgtggaagatgcaattgtctcttttgtatggtgaattc |
313 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
10868405 |
cattggtgaattctgttttgtgg-gagctttttgtgcggaagatgtgatagtctcttttgtatggtgaattc |
10868475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 358 - 399
Target Start/End: Original strand, 31607214 - 31607255
Alignment:
| Q |
358 |
actttcttactgttaagtttcaattttcaatggtgacattac |
399 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
31607214 |
actttcttactgttaagtttcaattttctatggtcacattac |
31607255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 313
Target Start/End: Complemental strand, 10885960 - 10885892
Alignment:
| Q |
245 |
tggtgaattatgttttgtggtgcactttttgtgtggaagatgcaattgtctcttttgtatggtgaattc |
313 |
Q |
| |
|
||||||||| |||||| |||| |||||||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
10885960 |
tggtgaattcagttttgcggtgagctttttgtgtggaagacgtgatagtctcttttgtatggtgaattc |
10885892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: scaffold0209
Description:
Target: scaffold0209; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 271 - 320
Target Start/End: Original strand, 5927 - 5976
Alignment:
| Q |
271 |
ttttgtgtggaagatgcaattgtctcttttgtatggtgaattcagtttag |
320 |
Q |
| |
|
||||||| |||||||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
5927 |
ttttgtggggaagatgcaatagtctcttttgtgtggtgaattcaatttag |
5976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 271 - 320
Target Start/End: Original strand, 19381 - 19430
Alignment:
| Q |
271 |
ttttgtgtggaagatgcaattgtctcttttgtatggtgaattcagtttag |
320 |
Q |
| |
|
||||||| |||||||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
19381 |
ttttgtggggaagatgcaatagtctcttttgtgtggtgaattcaatttag |
19430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University