View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4753_high_19 (Length: 211)
Name: NF4753_high_19
Description: NF4753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4753_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 48357221 - 48357399
Alignment:
| Q |
15 |
cataggggaacatggcgtggatttgatgtggcagtgaagtgcatttcacctgaattctttcgcacaaatgcaaacggtgttgaattctttgctcaagagg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357221 |
cataggggaacatggcgtggatttgatgtggcagtgaagtgcatttcacctgaattctttcgcacaaatgcaaacggtgttgaattctttgctcaagagg |
48357320 |
T |
 |
| Q |
115 |
ttgaaactctctcaaagcaacgccacaggtttgtgcttaatctaatgggtgcatgtcttgaccctcctaatcatgcttg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357321 |
ttgaaactctctcaaagcaacgccacaggtttgtgcttaatctaatgggtgcatgtcttgaccctcctaatcatgcttg |
48357399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University