View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4755_high_1 (Length: 279)
Name: NF4755_high_1
Description: NF4755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4755_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 30407200 - 30406930
Alignment:
| Q |
1 |
gcctagaggacacttgtttgtattttctctaaaataattccaacattaagttgaaggaggttgtttatgtgatgtagttaaagtcatatctgtttggaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30407200 |
gcctagaggacacttgtttgtattttctttaaaataattccaacattaagttgaaggaggttgtttatgtgatgtagttaaagtcatatctgtttggata |
30407101 |
T |
 |
| Q |
101 |
aggagattgacggtttaggggcacggagaatgagggagtttaatatggttggataaatggtattggaggtaggtggcagacaaagggtctttggtttaga |
200 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30407100 |
aggagattggcggtttaggggcaaggagaatgagggagtttaatatggttggataaatggtattggaggtaggtggcagacgaagggtctttggtttaga |
30407001 |
T |
 |
| Q |
201 |
ctcttggctgctagatatggcctagcggggggtcgagtacctttattttggtaggtgggttgatgatgtcc |
271 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30407000 |
ctcttggctgctagatatggcctagtgggggatcgagtacctttattttggtaggtgggttgatgatgtcc |
30406930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 30403197 - 30403149
Alignment:
| Q |
30 |
taaaataattccaacattaagttgaaggaggttgtttatgtgatgtagt |
78 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| | ||||||| |
|
|
| T |
30403197 |
taaaataattccaatattaagttggaggaggttgtttatattatgtagt |
30403149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University