View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4755_low_2 (Length: 322)
Name: NF4755_low_2
Description: NF4755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4755_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 60 - 233
Target Start/End: Complemental strand, 44999716 - 44999549
Alignment:
| Q |
60 |
aaattgaccctttctattatgatatgatatgattgtagtgtggcagccaaaaagtatcctcaaaaccgtatgttgggatggcgtgaatttgttgatggaa |
159 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999716 |
aaattgaccctttctat---gatatgatatgattgtagtgtggcagccaaaaagtatcctcaaaaccgtatgttgggatggcgtgaatttgttgatggaa |
44999620 |
T |
|
| Q |
160 |
aggtatttttatgatgacagtcagtccattttattttgtgtttatgtcatgtagactatatgacaaggaaattg |
233 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999619 |
aggtattttt---atgacagacagtccattttattttgtgtttatgtcatgtagactatatgacaaggaaattg |
44999549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 267 - 311
Target Start/End: Complemental strand, 44999520 - 44999476
Alignment:
| Q |
267 |
gtttggatcatatgtgtggaagacatataagcaagtttatgatga |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999520 |
gtttggatcatatgtgtggaagacatataagcaagtttatgatga |
44999476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 115 - 163
Target Start/End: Original strand, 38764175 - 38764223
Alignment:
| Q |
115 |
atcctcaaaaccgtatgttgggatggcgtgaatttgttgatggaaaggt |
163 |
Q |
| |
|
||||||||||||| ||| | ||||||||| || |||||||||||||||| |
|
|
| T |
38764175 |
atcctcaaaaccgcatgcttggatggcgtaaaattgttgatggaaaggt |
38764223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University