View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4756-Insertion-3 (Length: 465)
Name: NF4756-Insertion-3
Description: NF4756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4756-Insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 411; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 411; E-Value: 0
Query Start/End: Original strand, 8 - 446
Target Start/End: Original strand, 54490119 - 54490556
Alignment:
| Q |
8 |
tggttatgcaatgaaattggtaacgctttgaaaggatcaccgatcgatacattgattcgatcttgtcttctagaggagcgatctggtgcgtcatcttaca |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54490119 |
tggtcatgcaatgaaattggtaacgctttgaaaggatcaccgatcgatacattgattcgatcttgtcttctagaggagcgatctggtgcgtcatcttaca |
54490218 |
T |
|
| Q |
108 |
attacgatgcacctggagctgcttattctctcaaatggactttccacaatgatctaggtcttgtttttgttgctgtttatcagcgaattctgcatctgct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54490219 |
attacgatgcacctggagctgcttattctctcaaatggactttccacaatgatctaggtcttgttttcgttgctgtttatcagcgaattctgcatctgct |
54490318 |
T |
|
| Q |
208 |
ttatgtggatgatttgcttgctgctgttaagcgtgaattctcgcaggtttatgatcccaccagaactgtgtatcgtgattttgatcagatctttaagcag |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54490319 |
ttatgtggatgatttgcttgctgctgttaagcgtgaattctcgcaggtttatgatcccacccgaactgtgtatcgtgattttgatgagatctttaagcag |
54490418 |
T |
|
| Q |
308 |
ttgaagattgaagctgaggctcgtgctgaggatttgaagaaatcgaatccggtgattgtaggtgggaataggaaacagcaggtgacatggaaagggggat |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
54490419 |
ttgaagattgaagctgaggctcgtgctgaggatttgaagaaatcgaatccggtgattgtaggtgggaataggaaacagcaggtgacatgg-aagggagat |
54490517 |
T |
|
| Q |
408 |
ggatctgatgggaagaagaatggaagtgctggtggtggt |
446 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54490518 |
ggatctgatgggaagaagaatggaagtgctggtggtggt |
54490556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University