View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4756-Insertion-7 (Length: 42)
Name: NF4756-Insertion-7
Description: NF4756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4756-Insertion-7 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.00000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 42
Target Start/End: Complemental strand, 31000755 - 31000721
Alignment:
| Q |
8 |
cttttctctcttttcatacccaatttttcacattt |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31000755 |
cttttctctcttttcatacccaatttttcacattt |
31000721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 42
Target Start/End: Original strand, 24729655 - 24729689
Alignment:
| Q |
8 |
cttttctctcttttcatacccaatttttcacattt |
42 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24729655 |
cttttctctgttttcatacccaatttttcacattt |
24729689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University