View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4756_high_10 (Length: 256)
Name: NF4756_high_10
Description: NF4756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4756_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 40021035 - 40021272
Alignment:
| Q |
1 |
atcacaaattgttcaattgcttgaggaagttggggagtctgggaagatgatcaagtcactgaatgaaaaagctgctgagattgtcggtagagagataaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40021035 |
atcacaaattgttcaattgcttgaggaagttggggagtctgggaagatgatcaagtcactgaatgaaaaagctgctgagattgtcggtagagagataaat |
40021134 |
T |
|
| Q |
101 |
gggatacatggtgaagagaaggattttaagttgcagtggccgattgtagcagcgggagcaggaactacagtagcagtttttagtgcagctgcgttgatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
40021135 |
gggatacatggtgaagagaaggattttaagttgcagtggccgattgtagcagcgggagcaggaactacggtagcagtttttggtgcagctgcgttgatct |
40021234 |
T |
|
| Q |
201 |
atgtgtactgcgccaaacggaggtgatttttctgtgat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40021235 |
atgtgtactgcgccaaacggaggtgatttttctgtgat |
40021272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University