View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4757-Insertion-3 (Length: 413)
Name: NF4757-Insertion-3
Description: NF4757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4757-Insertion-3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 8 - 294
Target Start/End: Original strand, 41648481 - 41648764
Alignment:
| Q |
8 |
gaatgaccagcgtgggtgtaattgaatgcgaagtagcgtaattgagataacgcgagggttgctttttcctttgaaggttttgatcgaaacgcagcagcag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41648481 |
gaatgaccagcgtgggtgtaattgaatgcgaagtagcgtaattgagataacgcgagggttgctttttcctttgaaggttttgatcgaaacgcagcagcag |
41648580 |
T |
 |
| Q |
108 |
cagccataaggttgaatttgatttgatttgattagatttgggannnnnnnagagagatgaacaaaacattgattcttgggtatgtgtgtttattaaggat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41648581 |
cagccataaggttgaatttgatttgattagattagatttgggatttttttagagagatgaacaaaacattgattcttgggtatgtgtgt---ttaaggat |
41648677 |
T |
 |
| Q |
208 |
ttgtgaggtgaatctattatctatgaatatggtgttgttgtcttattctgagaatcgagtttgcggttgcgggaagggattgaacac |
294 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41648678 |
ttgtgaagtgaatctattatctatgaatatggtgttgttgtcttattctgagaatcgagtttgcggttgcgggaagggattgaacac |
41648764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 365 - 413
Target Start/End: Original strand, 41648834 - 41648882
Alignment:
| Q |
365 |
agtggttcatgtccaaactcgaaactgcaatgttgcaccactcatgact |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41648834 |
agtggttcatgtccaaactcgaaactgcaatgttgcaccactcatgact |
41648882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University