View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4757-Insertion-5 (Length: 247)
Name: NF4757-Insertion-5
Description: NF4757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4757-Insertion-5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 3243104 - 3242949
Alignment:
| Q |
7 |
aaaaaacatgacaatgatgattacgttggaaactggaattcactcgatcaccaaccatggatagccattcaagaaaaagctgtctgagtacatctgagaa |
106 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3243104 |
aaaaaacatgacaatgatgattacataggaaactggaattcaatcgatcaccaaccatggatagccattcaagaaaaagctgtctgagtacatctgagaa |
3243005 |
T |
|
| Q |
107 |
tcacacttagagaagttcttaatcgtccatgtgaattgctcaatcgtccatgggga |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3243004 |
tcacacttagagaagttcttaatcgtccatgtgaattgctcaatcgtccatgggga |
3242949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 184 - 247
Target Start/End: Complemental strand, 3242966 - 3242903
Alignment:
| Q |
184 |
ctcaatcgtccatggggaccatggggatatattctccatctcagcagcctaacagcttcaactc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3242966 |
ctcaatcgtccatggggaccatggggatatgttctccatctcagcagcctaacagcttcaactc |
3242903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 89 - 182
Target Start/End: Complemental strand, 3238887 - 3238794
Alignment:
| Q |
89 |
tctgagtacatctgagaatcacacttagagaagttcttaatcgtccatgtgaattgctcaatcgtccatggggatatattctcaaatgctttac |
182 |
Q |
| |
|
||||||||| ||| ||||||||| || |||||||| ||||||||||||||||||||||||||||||| ||||||| | ||||||| |||||||| |
|
|
| T |
3238887 |
tctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctggggatttcttctcaattgctttac |
3238794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University