View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4757-Insertion-8 (Length: 86)
Name: NF4757-Insertion-8
Description: NF4757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4757-Insertion-8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 9e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 9e-36
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 9704759 - 9704834
Alignment:
| Q |
8 |
atattatgttattaccaaaacaaaaaagaatttgatgagttggttgtgtgctgtgtatccttgtaatgtatcattg |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9704759 |
atattatgttattaccaaaacaaaaaagaatttgatgagttggttgtgtgctgtgtatccttgtaatgtatcattg |
9704834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University