View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4757_high_11 (Length: 251)
Name: NF4757_high_11
Description: NF4757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4757_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 34 - 241
Target Start/End: Original strand, 50573265 - 50573472
Alignment:
| Q |
34 |
caaaagctttgttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaacaatttgtgnnnnnnnct |
133 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
50573265 |
caaaagcttggttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaacaatttgtgtttttttct |
50573364 |
T |
|
| Q |
134 |
cgtaatacttgattccttagcctttatttatgctttaggatttcaagattcgaagccatatgaatgtcaacttccgcagatggttggatggtcttgcgtg |
233 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
50573365 |
cgtaatacttgattcctttgcctttatttatgctttaggatttcaagattcgcagccagatgaatgtcaacttccgcaaatggttggatggtcttgcgcg |
50573464 |
T |
|
| Q |
234 |
ttcctatg |
241 |
Q |
| |
|
|||||||| |
|
|
| T |
50573465 |
ttcctatg |
50573472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 183
Target Start/End: Original strand, 50562094 - 50562138
Alignment:
| Q |
139 |
tacttgattccttagcctttatttatgctttaggatttcaagatt |
183 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||||||| ||||| |
|
|
| T |
50562094 |
tacttgattccttcggctttacttatgctttaggatttccagatt |
50562138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University