View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4757_high_13 (Length: 215)
Name: NF4757_high_13
Description: NF4757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4757_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 36876516 - 36876333
Alignment:
| Q |
18 |
ttcaaaacttcgcaaggttaatttctctggtaatttctacattaatgactcgttgttttatgaactgtgagctttccacgtgctggttagtgagctttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36876516 |
ttcaaaacttcgcaaggttaatttctctggtaatttctacattaatgactcgttgttttatgaactgtgatctttccacgtgctggttagtgagctttta |
36876417 |
T |
|
| Q |
118 |
gaaggttaatttctactttaatctctctggtggttatgtttgattgtcctttcctaaaacgctggtatttgaaatctttctctg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36876416 |
gaaggttaatttctactttaatctctctggtggttatgtttgattgtcctttcctaacacgctggtatttgaaatctttctctg |
36876333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 33397439 - 33397389
Alignment:
| Q |
18 |
ttcaaaacttcgcaaggttaatttctctggtaatttctacattaatgactc |
68 |
Q |
| |
|
||||||||| |||||||||||| |||||||| |||||||| |||||||||| |
|
|
| T |
33397439 |
ttcaaaactccgcaaggttaatctctctggtcatttctacgttaatgactc |
33397389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 18723566 - 18723634
Alignment:
| Q |
18 |
ttcaaaacttcgcaaggttaatttctctggtaatttctacattaatgactcgttgttttatgaactgtg |
86 |
Q |
| |
|
||||||||| ||||| |||||| | ||||||||| ||||||||||||| || ||||||| | ||||||| |
|
|
| T |
18723566 |
ttcaaaactccgcaaagttaatctttctggtaatatctacattaatgattcattgttttttcaactgtg |
18723634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University