View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4757_low_8 (Length: 318)
Name: NF4757_low_8
Description: NF4757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4757_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 20 - 303
Target Start/End: Original strand, 38892996 - 38893279
Alignment:
| Q |
20 |
ctaatgtatgaattgaagtgaaatatagtgaaaagagatagatttcgcacccaaaatatttgttttattttgcgatcgatttcaccacaaccgccgtcac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
38892996 |
ctaatgtatgaattgaagtgaaatatagtgaaaagagatagatttcgcacccaaaatatttgttttattttgctatcgaattcaccaccaccgccgtcac |
38893095 |
T |
 |
| Q |
120 |
ctccggtcaccatttccgtcgaattccggcgacgccacgctccgaacaccggtaactctcaatctatttctcagatcgatttaactgatttaagatctca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38893096 |
ctccggtcaccatttccgtcgaattccggcgacgccacgctcctaacaccggtaactctcaatctatttctcagatcgatttaactgatttaagatctca |
38893195 |
T |
 |
| Q |
220 |
ccgcggtttctccttttcatttttgaattcactcgtttcaaattcaatttcaatttacaaatatattttgtttaaaatgttcat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38893196 |
ccgcggtttctccttttcatttttgaattcactcgtttcaaattcaatttcaatttacaaatatattttgtttaaaatgttcat |
38893279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University