View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4758-Insertion-17 (Length: 200)
Name: NF4758-Insertion-17
Description: NF4758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4758-Insertion-17 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
| [»] scaffold0161 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 8 - 200
Target Start/End: Complemental strand, 32457290 - 32457098
Alignment:
| Q |
8 |
acttggtctcaaacccacaaaagatgtcttcaacttgcttcatcactttcttccctcggcatccaaaaaggcgatgtcgtctccgtcctttcccccaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32457290 |
acttggtctcaaacccacaaaagatgtcttcaacttgcttcatcactttcttccctcggcatccaaaaaggcgatgtcgtctccgtcctttcccccaaca |
32457191 |
T |
|
| Q |
108 |
ctccggccatgtatgagcttcatttctccgttccaatgtccggcgccattctcaataacctcaacttccgacttgaccacaaaaccctctccg |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32457190 |
ctccggccatgtacgagcttcatttctccgttccaatgtccggcgccattctcaataacctcaacttccgacttgaccacaaaaccctctccg |
32457098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 8 - 198
Target Start/End: Original strand, 32463845 - 32464035
Alignment:
| Q |
8 |
acttggtctcaaacccacaaaagatgtcttcaacttgcttcatcactttcttccctcggcatccaaaaaggcgatgtcgtctccgtcctttcccccaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32463845 |
acttggtctcaaacccacaaaagatgtcttcaacttgcttcatcactttcttccctcggcatccaaaaaggcgacgtcgtctccgtcctttcccccaaca |
32463944 |
T |
|
| Q |
108 |
ctccggccatgtatgagcttcatttctccgttccaatgtccggcgccattctcaataacctcaacttccgacttgaccacaaaaccctctc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
32463945 |
ctccggccatgtatgagcttcatttctccgttccaatgtccggcgccattctcaataacctcaacttccgactcgaccacaaaagcctctc |
32464035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 11 - 200
Target Start/End: Original strand, 23272 - 23461
Alignment:
| Q |
11 |
tggtctcaaacccacaaaagatgtcttcaacttgcttcatcactttcttccctcggcatccaaaaaggcgatgtcgtctccgtcctttcccccaacactc |
110 |
Q |
| |
|
|||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
23272 |
tggtttcaaacccataaacgatgtcttcaacttgcttcatcactttcttccctcggcatcgtaaaaggcgacgtcgtctccgtcctctctcccaacactc |
23371 |
T |
|
| Q |
111 |
cggccatgtatgagcttcatttctccgttccaatgtccggcgccattctcaataacctcaacttccgacttgaccacaaaaccctctccg |
200 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
23372 |
cggccatgtacgagctacaattctccgttccaatgtccggcgccattctcaacaacctcagcttccgacttgactacaaaaccctctccg |
23461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University