View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4758-Insertion-21 (Length: 115)
Name: NF4758-Insertion-21
Description: NF4758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4758-Insertion-21 |
 | |
|
| [»] scaffold1252 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold1252 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: scaffold1252
Description:
Target: scaffold1252; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 115
Target Start/End: Original strand, 743 - 850
Alignment:
| Q |
8 |
agaatttggttaagcgtgcagtttgttctgctgctgtgttgaatctccgaatagctgccagcatagctttagtgtgttccgcctaaatacagcgccttcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
743 |
agaatttggttaagcgtgcagtttgttctgctgctgtgttgaatctccgaatagctgccagcatagctttagtgtgttccgcctaaatacagcgccttcc |
842 |
T |
|
| Q |
108 |
gtttgtat |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
843 |
gtttgtat |
850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.0000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 8 - 77
Target Start/End: Complemental strand, 20873815 - 20873746
Alignment:
| Q |
8 |
agaatttggttaagcgtgcagtttgttctgctgctgtgttgaatctccgaatagctgccagcatagcttt |
77 |
Q |
| |
|
||||||| |||| ||||||||||||||||| |||||| | ||||||||| | ||||||||||||||||| |
|
|
| T |
20873815 |
agaatttagttagacgtgcagtttgttctgccgctgtgctcaatctccgactggctgccagcatagcttt |
20873746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University