View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4758_high_6 (Length: 253)
Name: NF4758_high_6
Description: NF4758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4758_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 44574257 - 44574481
Alignment:
| Q |
19 |
aaaggtgtcttttatgggcattgacaaagtgtcgttgtgggattggtgagaaattgttatgactgacgctccatcaaagaagaacttcaatgttagttag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
44574257 |
aaaggtgtcttttatgggcattgacaaagtgtcgttgcgggattggtgaaaaattgttatgactgacgctccatcaaaaaagaacttcggtgttagttag |
44574356 |
T |
|
| Q |
119 |
gagttgttgaaacattacaaaatggaggaatttgatggtttatccgttgagacaagacaaaagaaatttaagattaatgggtcagattcctttgtgaata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574357 |
gagttgttgaaacattacaaaatggaggaatttgatggtttacccgttgagacaagacaaaagaaatttaagattaatgggtcagattcctttgtgaata |
44574456 |
T |
|
| Q |
219 |
ggcctttctagtgcttggacctatg |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44574457 |
ggcctttctagtgcttggacctatg |
44574481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University