View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4758_low_12 (Length: 238)
Name: NF4758_low_12
Description: NF4758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4758_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 12558089 - 12557868
Alignment:
| Q |
1 |
tatttggaggaaggtgtcgtttatcatatttgtagccacagttgcttctgttttgatctgctcagttgtagcagcagctgttgcttctccacatgttgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12558089 |
tatttggaggaaggtgtcgtttatcatatttgtagccacagttgcttctgttttgatctgctcagttgtagcagcagctgttgcttctccacatgttgca |
12557990 |
T |
 |
| Q |
101 |
gctgctgtagctgctgttactgctatcccaattggttcaatgggaaagtggatcgattcacttatgaagaactatgaaaatgcattgaaaggtcataagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12557989 |
gctgctgtagctgctgttactgctatcccaattggttcaatgggaaagtggatcgactcacttatgaagaactatgaaaatgcattgaaaggtcataagg |
12557890 |
T |
 |
| Q |
201 |
aagtaactatctcaatggaagt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12557889 |
aagtaactatctcaatggaagt |
12557868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 26 - 192
Target Start/End: Complemental strand, 25997117 - 25996951
Alignment:
| Q |
26 |
atatttgtagccacagttgcttctgttttgatctgctcagttgtagcagcagctgttgcttctccacatgttgcagctgctgtagctgctgttactgcta |
125 |
Q |
| |
|
||||||||||| ||| |||| ||||||| || || || ||||| || |||||| |||| |||||| |||||| || ||| |||| || | ||| | | |
|
|
| T |
25997117 |
atatttgtagcaacatttgcagctgttttaatatgttctgttgtggctgcagctattgcagctccacctgttgctgcggctttagcagccgctacatcga |
25997018 |
T |
 |
| Q |
126 |
tcccaattggttcaatgggaaagtggatcgattcacttatgaagaactatgaaaatgcattgaaagg |
192 |
Q |
| |
|
|||| || ||||| |||||||| ||||| ||||||||| || |||||||||| |||||||||||| |
|
|
| T |
25997017 |
tccctatcggttcgatgggaaaatggattgattcactttggagaaactatgaaattgcattgaaagg |
25996951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University