View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4759-Insertion-12 (Length: 92)
Name: NF4759-Insertion-12
Description: NF4759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4759-Insertion-12 |
 | |
|
| [»] scaffold0743 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0743 (Bit Score: 39; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0743
Description:
Target: scaffold0743; HSP #1
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 1992 - 1946
Alignment:
| Q |
46 |
agactaagtttgtaagtggtttatgcagctcctgaaattttattgca |
92 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1992 |
agactaagcttgtaagtgatttatgcagctcctgaaattttattgca |
1946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 47 - 92
Target Start/End: Complemental strand, 52773585 - 52773540
Alignment:
| Q |
47 |
gactaagtttgtaagtggtttatgcagctcctgaaattttattgca |
92 |
Q |
| |
|
|||||| |||||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
52773585 |
gactaactttgtaagcggttgaggcagctcctgaaattttattgca |
52773540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University