View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4759-Insertion-13 (Length: 171)
Name: NF4759-Insertion-13
Description: NF4759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4759-Insertion-13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 8 - 171
Target Start/End: Complemental strand, 45467287 - 45467127
Alignment:
| Q |
8 |
gttctaccagtaaatgatagtatgctctggcatagaccatttgaatcagtcttaaaccaatatgggctttgtaagttgttctataagcccaaagagtatc |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45467287 |
gttctaccagtaaatgata---tgctctggcatagaccatttgaatcagtcttaaaccaatatgggctttgtaagttgttctataagcccaaagagtacc |
45467191 |
T |
 |
| Q |
108 |
attctgcctaagagaccaaccttttcttgaattcgcgattgtcatcttcaaaattctcttgatc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45467190 |
attctgcctaagagaccaaccttttcttgaattcgcgattgtcatcttcaaaattctcttgatc |
45467127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University