View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4759_high_24 (Length: 205)
Name: NF4759_high_24
Description: NF4759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4759_high_24 |
 |  |
|
| [»] scaffold0743 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0743 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: scaffold0743
Description:
Target: scaffold0743; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 31 - 174
Target Start/End: Original strand, 2051 - 2194
Alignment:
| Q |
31 |
tggaaggaaaagatacaactttactactctagtagtaaaagacacataacaatattgtttcggtatgagtcgaggctcaaactagtgtaatgtccagact |
130 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2051 |
tggaaggaaaagatacaacttaactgctctagtagaaaatgacacataaccatattgtttcggtatgagtcgaggctcaaactagtgtaatgtctagact |
2150 |
T |
 |
| Q |
131 |
tccatattgaatgtcaaggtggaccaaagtatggaattgtccta |
174 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
2151 |
tccatattgtatgtcaaggtggactaaagtatggaatcgtccta |
2194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University