View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4759_high_7 (Length: 397)
Name: NF4759_high_7
Description: NF4759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4759_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 7e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 48856950 - 48857153
Alignment:
| Q |
16 |
gatgaaggcttcgttggatgagaagggttgcattgtgtctgatgaagatgatttttggggtgagattgaattgccggagctgatggagagtgattcgtcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48856950 |
gatgaaggcttcgttggatgagaagggttgcattgtgtctgatgaagatgatttttggggtgagattgaattgccggagctgatggagagtgattcgtcg |
48857049 |
T |
|
| Q |
116 |
tggagttgctccggtgatatcatgacgtggccagaagttgaggttttggctcagcaacatttcatgtcgtcgtgtctataaataaataaatgttggtctg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48857050 |
tggagttgctccggtgatatcatgacgtggccagaagttgaggttttggcgcagcaacatttcatgtcgtcgtgtctataaataaac----gttggtctg |
48857145 |
T |
|
| Q |
216 |
tttcttgc |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
48857146 |
tttcttgc |
48857153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 305 - 381
Target Start/End: Original strand, 48857234 - 48857312
Alignment:
| Q |
305 |
aaaactctttttctttctccccc--ttaagtaactaataagttacaatattttccttaatttaactaatgcgtaatatg |
381 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48857234 |
aaaactctttttctttctcccccctttaagtaactaataagttacaatattttccttaatttaactaatgcataatatg |
48857312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 62 - 96
Target Start/End: Complemental strand, 9776348 - 9776314
Alignment:
| Q |
62 |
gatgatttttggggtgagattgaattgccggagct |
96 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9776348 |
gatgatttttggggtgagattgagttgccggagct |
9776314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University