View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4759_low_21 (Length: 241)
Name: NF4759_low_21
Description: NF4759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4759_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 6318422 - 6318608
Alignment:
| Q |
15 |
caaaggtgaaggtggattagtagcagcaaatcccaacttatttttatttcatttattataataaattcatgcgccaaatttctcaacagaatgtctccaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6318422 |
caaaggtgaaggtggattagtagcagcaaatcccaacttatttttatttcatttattataataaattcatgcgccaaatttctcaacagaatgtttccaa |
6318521 |
T |
|
| Q |
115 |
atctgtcagcgaaactaacaacccctcgtacaagcaaatcaatgtatacatgaaattcaacaaataaaattatacttgcggtgagta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6318522 |
atctgtcagcgaaactaacaacccctcgtacaagcaaatcaatgtatatatgaaattcaacaaataaaattatacttgcggtgagta |
6318608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University