View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4759_low_23 (Length: 226)
Name: NF4759_low_23
Description: NF4759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4759_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 4702279 - 4702071
Alignment:
| Q |
1 |
aggattaggccgcaaaatctctttgccagtctagtgccctgtagggcaatagagcaaaacagcctaaacnnnnnnngaagtgtttaggggaaaacttaca |
100 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4702279 |
aggattaggccgcaaaatctctggtctagtctagtgccctgtagggcaatagagcaaaacagcctaaactttttttgaagtgtttaggggaaaacttaca |
4702180 |
T |
 |
| Q |
101 |
agggagttaatgcaatttccccttaaattaaacatggagtggattcaaaaaatgaagtcaatcacatgagcaacaacaggtacaaggaaacaatgaaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702179 |
ggggagttaatgcaatttccccttaaattaaacatggagtggattcaaaaaatgaagtcaatcacatgagcaacaacaggtacaaggaaacaatgaaaag |
4702080 |
T |
 |
| Q |
201 |
tcagaaagt |
209 |
Q |
| |
|
| ||||||| |
|
|
| T |
4702079 |
taagaaagt |
4702071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University