View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4760-Insertion-7 (Length: 90)
Name: NF4760-Insertion-7
Description: NF4760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4760-Insertion-7 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 6e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 6e-40
Query Start/End: Original strand, 8 - 90
Target Start/End: Original strand, 3381657 - 3381739
Alignment:
| Q |
8 |
aaattggtatgaatttgaagagaggtttcttaagagatttttcctgcacaacagattcatggaggccaagacaactattgcca |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3381657 |
aaattggtatgaatttgaagagaggtttcttaagagatttttcctgcacaacagattcatggaggccaagacaactattgcca |
3381739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 8 - 90
Target Start/End: Original strand, 1488993 - 1489075
Alignment:
| Q |
8 |
aaattggtatgaatttgaagagaggtttcttaagagatttttcctgcacaacagattcatggaggccaagacaactattgcca |
90 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1488993 |
aaattggtatgaattttaagagagatttcttaagaaatttttcccgcacaacagattcatggaggccaagacaactattgcca |
1489075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University